ID: 1005480012

View in Genome Browser
Species Human (GRCh38)
Location 6:26246832-26246854
Sequence GGCGGTGTCAAGCGCATCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005480012_1005480021 9 Left 1005480012 6:26246832-26246854 CCCAAGATGCGCTTGACACCGCC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1005480021 6:26246864-26246886 CAAGCGCCGGATAGTGCACTTGG 0: 1
1: 0
2: 0
3: 3
4: 30
1005480012_1005480017 -4 Left 1005480012 6:26246832-26246854 CCCAAGATGCGCTTGACACCGCC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1005480017 6:26246851-26246873 CGCCATGCCGGGCCAAGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005480012 Original CRISPR GGCGGTGTCAAGCGCATCTT GGG (reversed) Exonic
902924377 1:19686289-19686311 TCCGGTCTCATGCGCATCTTTGG - Intronic
911369884 1:96984105-96984127 GACGGTGTAAAACGCATCATGGG + Intergenic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
920522193 1:206635829-206635851 GGCGCTGGCAAGCGAAGCTTGGG + Intronic
1062890587 10:1056857-1056879 AGCGGTGTCCTGCGCGTCTTCGG + Intronic
1072101981 10:92238298-92238320 GGCAGTGTCCTGGGCATCTTGGG - Intronic
1086723032 11:90145241-90145263 GGCGCTGTAATGCCCATCTTGGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1135659110 16:24279115-24279137 GGCCGTGTCATGCAGATCTTTGG + Intronic
1138439390 16:57025220-57025242 GGGGGTGTCAAGAGCACCATAGG - Intronic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1155709180 18:28854694-28854716 GGCTGTCTCAAGCTCATCTATGG - Intergenic
1166543437 19:43620349-43620371 GGCCGGGGCAAGCGCCTCTTAGG - Intergenic
930246861 2:48992449-48992471 GGCTGTGTGGAGAGCATCTTTGG - Intronic
940970430 2:159891117-159891139 GGCTGTGTCAAGTGCATCCCAGG + Intronic
1178352273 21:31880778-31880800 GGTTGTGGCAAGCGGATCTTGGG + Intronic
975715356 4:77200331-77200353 GCCAGTCTCAAGCTCATCTTTGG - Intronic
992409234 5:76489086-76489108 GGCTGTGTCAAGCGCAAGCTGGG - Intronic
997519785 5:134515528-134515550 TGTGGTCTCAAGCTCATCTTGGG - Intergenic
1003366551 6:5480610-5480632 GACGGTTTCAAGCACATTTTGGG + Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1010499593 6:76580868-76580890 GGTGATTTCAAGTGCATCTTAGG - Intergenic
1019516706 7:1443252-1443274 GGGGGTGTCCAGGGCATCCTAGG - Intronic
1021767891 7:23967798-23967820 GGCTGTATAAAGGGCATCTTTGG - Intergenic
1021846835 7:24771472-24771494 GACGGTGCCAAGCACATATTAGG - Intergenic
1030107444 7:105998961-105998983 GGCAGTGTCATGCACACCTTGGG + Intronic
1030174459 7:106637015-106637037 TGCTGTCTCAAGGGCATCTTAGG - Intergenic
1031433155 7:121698076-121698098 GGCGGTGTCATGCCCCTCTGAGG + Intergenic
1036826467 8:11980122-11980144 GGCGGTGTCAGGATCATCTCAGG + Intergenic
1037403242 8:18515115-18515137 GGCGGTGGCACTAGCATCTTGGG + Intergenic
1194887304 X:99332503-99332525 TGTGGTGTCTAGAGCATCTTTGG + Intergenic
1196399686 X:115300753-115300775 GGTGGTGCCAAGAGCATCTCTGG - Intronic