ID: 1005482987

View in Genome Browser
Species Human (GRCh38)
Location 6:26272393-26272415
Sequence TGCGCCGGTGTACCTGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 7, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005482987_1005483000 16 Left 1005482987 6:26272393-26272415 CCGCCTCCAGGTACACCGGCGCA 0: 1
1: 0
2: 7
3: 6
4: 74
Right 1005483000 6:26272432-26272454 TGGCGTAGTTGCCCTTGCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 24
1005482987_1005482999 13 Left 1005482987 6:26272393-26272415 CCGCCTCCAGGTACACCGGCGCA 0: 1
1: 0
2: 7
3: 6
4: 74
Right 1005482999 6:26272429-26272451 GCTTGGCGTAGTTGCCCTTGCGG 0: 1
1: 0
2: 4
3: 6
4: 57
1005482987_1005483001 19 Left 1005482987 6:26272393-26272415 CCGCCTCCAGGTACACCGGCGCA 0: 1
1: 0
2: 7
3: 6
4: 74
Right 1005483001 6:26272435-26272457 CGTAGTTGCCCTTGCGGAGGAGG 0: 1
1: 1
2: 1
3: 6
4: 41
1005482987_1005483002 22 Left 1005482987 6:26272393-26272415 CCGCCTCCAGGTACACCGGCGCA 0: 1
1: 0
2: 7
3: 6
4: 74
Right 1005483002 6:26272438-26272460 AGTTGCCCTTGCGGAGGAGGCGG 0: 1
1: 2
2: 5
3: 15
4: 176
1005482987_1005482993 -4 Left 1005482987 6:26272393-26272415 CCGCCTCCAGGTACACCGGCGCA 0: 1
1: 0
2: 7
3: 6
4: 74
Right 1005482993 6:26272412-26272434 CGCACCGGCCCGGACCCGCTTGG 0: 1
1: 0
2: 2
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005482987 Original CRISPR TGCGCCGGTGTACCTGGAGG CGG (reversed) Intergenic
900117241 1:1033921-1033943 GACGCCGGGGTCCCTGGAGGCGG + Intronic
908045382 1:60162742-60162764 TGCACCTGTGTACCTGGACAGGG - Intergenic
911027106 1:93447885-93447907 AGCTCCGGGGTACCTGCAGGAGG + Intergenic
914673219 1:149887754-149887776 CGCCCCGGTGTACCTGGCGGCGG - Exonic
922556493 1:226536600-226536622 TGCGCCGGACTCCCTGGTGGTGG - Intergenic
922581665 1:226702964-226702986 TGAGCTGGTGTAACTGCAGGAGG + Intronic
1073135782 10:101219326-101219348 TGCGCCCGTGTATGTGGGGGGGG - Intergenic
1077173383 11:1178259-1178281 TCCCCAGGTGTAGCTGGAGGTGG + Intronic
1077948349 11:6926865-6926887 TGTGCCGGAAAACCTGGAGGAGG + Intronic
1079064337 11:17276590-17276612 CGCGCCGGGGAGCCTGGAGGCGG - Intronic
1080262224 11:30361767-30361789 TAAGCCAGTGTGCCTGGAGGAGG - Intergenic
1084935825 11:72586169-72586191 CTCGTCGGTGAACCTGGAGGAGG + Exonic
1092238059 12:6822007-6822029 TGCCCTGGAGAACCTGGAGGGGG + Intronic
1093077711 12:14774611-14774633 GGCGCCGGTGTACCTGGCGGCGG + Exonic
1097102375 12:56598771-56598793 TGAGCTGGTGTACCTGGACAGGG + Exonic
1101150367 12:101877712-101877734 TGCTCCGGGCTGCCTGGAGGCGG - Exonic
1104390316 12:128386378-128386400 TGTGCCTGTGCCCCTGGAGGGGG - Intronic
1104846873 12:131851339-131851361 TGTGCCGGAGTCCCTGGGGGAGG + Exonic
1104876345 12:132037562-132037584 TGAGCAGGGGTAGCTGGAGGAGG + Intronic
1118475059 14:66109001-66109023 AGGGCCTGTGTACCTGGGGGAGG + Intergenic
1123552868 15:21399253-21399275 TGCAAGGGTGTACCTGGAGCAGG - Intergenic
1123704576 15:22941677-22941699 TGCTCAGGGGAACCTGGAGGTGG + Intronic
1124041672 15:26111180-26111202 GGAGCCTGTGTACCAGGAGGCGG + Intergenic
1132862051 16:2076594-2076616 TGCGGGGGTGTGCCTGGAGTCGG + Intronic
1136550292 16:30979327-30979349 TGCGGCGGTGTGGCTGGAGGGGG - Exonic
1141138536 16:81482432-81482454 GGCGCCTAAGTACCTGGAGGAGG + Intronic
1141969502 16:87471559-87471581 GGGGCCGGTGTTCCTAGAGGAGG - Intronic
1142279488 16:89140274-89140296 TGCCCCGGGGTAACTGGTGGAGG + Intronic
1152719834 17:81918026-81918048 GGCGGCGGCGTACCTGGCGGAGG + Exonic
1152743560 17:82029164-82029186 GGCGCGGCTGTCCCTGGAGGAGG + Exonic
1155346697 18:24864338-24864360 TGCTCTGGTGAACATGGAGGTGG + Intergenic
1160340152 18:78082720-78082742 TGCACCAGTGGACCTGGAGCTGG + Intergenic
1161380751 19:3963878-3963900 TGAGCCGCTGGGCCTGGAGGCGG - Exonic
1162573196 19:11484067-11484089 TGCGCCGATGTACCTCCAGGTGG + Exonic
1165393906 19:35553672-35553694 TGGGCCGGGGAGCCTGGAGGTGG - Intronic
1166266028 19:41685072-41685094 TAGGCCGCTGCACCTGGAGGAGG + Intronic
1167428377 19:49441302-49441324 TGCACCGGTGAGCCTGGCGGGGG - Exonic
1168308446 19:55449375-55449397 TGCGTCCGTGTGCCGGGAGGAGG - Intergenic
1168339586 19:55615487-55615509 GGAGCCGGTGCACCTGGCGGTGG - Exonic
948777498 2:240297265-240297287 TGCTCCTGTGAGCCTGGAGGAGG - Intergenic
1173514750 20:43657490-43657512 TGCGCAGGTACACCTGGAGCCGG - Intergenic
1174717806 20:52778555-52778577 TGCTGCTGTGTAACTGGAGGTGG - Intergenic
1175225795 20:57443118-57443140 AGAGCTGGTGTGCCTGGAGGTGG + Intergenic
1183619405 22:38964051-38964073 TGCTCTGGGGCACCTGGAGGAGG - Intronic
1183624552 22:38993646-38993668 TGCTCTGGGGAACCTGGAGGAGG - Intergenic
1184109534 22:42386976-42386998 AGCGCCTGTGTACCTGGGAGAGG + Exonic
1184903481 22:47463061-47463083 TGCTCAGGTGCATCTGGAGGTGG - Intronic
971660975 4:29415283-29415305 GGCGGTGGTGTACCTGGAGAGGG + Intergenic
976743439 4:88379526-88379548 TGCGCGGTTCTACCTGGAGAAGG + Intronic
985360642 4:189172026-189172048 TGCGCAGGTGTGTTTGGAGGAGG + Intergenic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
994458909 5:100049427-100049449 TGCGCCGGTGAAGCTTCAGGGGG + Intergenic
996315137 5:122152881-122152903 TTCTCTGGTGTACCAGGAGGCGG - Exonic
997570957 5:134927101-134927123 TGCGCCGGTGAAGCTTCAGGGGG + Intronic
999478817 5:151925936-151925958 TGCTGCGGTGACCCTGGAGGGGG - Intergenic
1001129593 5:169052925-169052947 TCAGCCTGTTTACCTGGAGGCGG - Intronic
1005457308 6:26033406-26033428 CGCGCCGGTGTATCTCGCGGCGG - Exonic
1005466887 6:26124373-26124395 CGCGCCGGTGTACCTGGCGGCGG + Exonic
1005474989 6:26199081-26199103 CGCGCCAGTGTATCTGGCGGCGG - Exonic
1005482987 6:26272393-26272415 TGCGCCGGTGTACCTGGAGGCGG - Intergenic
1005569735 6:27133212-27133234 CGCGCCGGTGTATCTGGCAGCGG + Exonic
1005571208 6:27147269-27147291 CGCGCCAGTGTACCTGGCTGCGG + Exonic
1005642372 6:27808350-27808372 AGCGCCGGTGTACCTGGCGGCGG + Exonic
1005642976 6:27814578-27814600 AGCGCCGGTGTACCTGGCGGCGG - Exonic
1005645898 6:27838177-27838199 AGCGCCGGTGTACCTGGCGGCGG - Exonic
1005648559 6:27865495-27865517 CGCGCCGGTGTACCTGGCGGCGG + Exonic
1005651956 6:27892987-27893009 CGCGCCGGTTTACCTGGCGGCGG - Exonic
1005844764 6:29768819-29768841 TGCCCAGGGGTTCCTGGAGGAGG - Intergenic
1007463690 6:42036529-42036551 TGCGCCTGTAGACCAGGAGGAGG - Intronic
1007789996 6:44303336-44303358 TGAGGCTGTGTACATGGAGGAGG - Exonic
1009045904 6:58237445-58237467 TCCTCCAGTGTACCTAGAGGAGG - Intergenic
1016014061 6:139166321-139166343 TAGGCCGGTGGACCTGGAGAAGG + Exonic
1019322187 7:420822-420844 TGGGCCAGTGCTCCTGGAGGAGG - Intergenic
1019347509 7:538186-538208 GGAGCCGGGGTCCCTGGAGGAGG + Intergenic
1021651127 7:22834585-22834607 TGCGCTGTTCTCCCTGGAGGCGG + Intergenic
1029307283 7:99629633-99629655 TGCGCTGGTGCACCTCCAGGTGG - Exonic
1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG + Exonic
1034538234 7:151739140-151739162 GGCTCCGGTGTAGCTGGAGCTGG + Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1049536874 8:143186505-143186527 TGCCCAGGTGTCCCAGGAGGGGG + Intergenic
1056762618 9:89425896-89425918 TGCCCTGGTGTCCCTGGAGGAGG - Intronic
1061728776 9:132597239-132597261 TGCACCAGTGTCCCTGGAGGAGG + Intronic
1062283042 9:135760403-135760425 TGGGCTGGGGTGCCTGGAGGAGG - Intronic
1062435390 9:136544691-136544713 TGTCCCGGTGCCCCTGGAGGCGG - Intronic
1202630379 M:11673-11695 TGCGCCGGTGAAGCTTCAGGGGG - Intergenic
1187020746 X:15378946-15378968 GGAGCCGGTGCAGCTGGAGGTGG - Intronic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic
1200258636 X:154599733-154599755 TGCACTGGTGTACCTGGAAAGGG - Intergenic