ID: 1005484281

View in Genome Browser
Species Human (GRCh38)
Location 6:26284831-26284853
Sequence AAGCTTAAACTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484277_1005484281 15 Left 1005484277 6:26284793-26284815 CCAACTTCTGTAGTCTTTGAGAA No data
Right 1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG No data
1005484278_1005484281 -8 Left 1005484278 6:26284816-26284838 CCTTACGAACGCTTCAAGCTTAA No data
Right 1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG No data
1005484276_1005484281 26 Left 1005484276 6:26284782-26284804 CCGCGAAGTTTCCAACTTCTGTA No data
Right 1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484281 Original CRISPR AAGCTTAAACTGAAGGAGGA AGG Intergenic
No off target data available for this crispr