ID: 1005484324

View in Genome Browser
Species Human (GRCh38)
Location 6:26285354-26285376
Sequence GGCGGTGTCAAGCGAATTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484324_1005484325 -10 Left 1005484324 6:26285354-26285376 CCAGAAATTCGCTTGACACCGCC 0: 1
1: 0
2: 2
3: 6
4: 36
Right 1005484325 6:26285367-26285389 TGACACCGCCGCGACGAGCAAGG 0: 1
1: 1
2: 0
3: 5
4: 10
1005484324_1005484327 -4 Left 1005484324 6:26285354-26285376 CCAGAAATTCGCTTGACACCGCC 0: 1
1: 0
2: 2
3: 6
4: 36
Right 1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG 0: 1
1: 3
2: 0
3: 11
4: 37
1005484324_1005484331 20 Left 1005484324 6:26285354-26285376 CCAGAAATTCGCTTGACACCGCC 0: 1
1: 0
2: 2
3: 6
4: 36
Right 1005484331 6:26285397-26285419 TAGCTGGCTTAGTGATGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 80
1005484324_1005484329 4 Left 1005484324 6:26285354-26285376 CCAGAAATTCGCTTGACACCGCC 0: 1
1: 0
2: 2
3: 6
4: 36
Right 1005484329 6:26285381-26285403 CGAGCAAGGCGCCGGATAGCTGG 0: 1
1: 3
2: 2
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484324 Original CRISPR GGCGGTGTCAAGCGAATTTC TGG (reversed) Exonic
900577936 1:3393627-3393649 GGCGGGGTCAGGCGACTTCCCGG - Intronic
900943478 1:5816472-5816494 GGCAGTGTCCAGAGAATTACTGG + Intergenic
912983869 1:114405728-114405750 GGTGGTGTCAAGCTACTCTCAGG + Exonic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
923274090 1:232381806-232381828 GGCAGTGTTAAGTGAAATTCAGG - Intergenic
1065256718 10:23876977-23876999 GGCGGTGTCAAGCCACTTAATGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1111797715 13:92944442-92944464 GGCAGAGGCAGGCGAATTTCTGG + Intergenic
1136515799 16:30767698-30767720 GGCAGTGTCAAGTTAATTTTGGG + Intronic
1138254435 16:55542361-55542383 GGAGCTGTGAAGCCAATTTCAGG + Intronic
1152823825 17:82450890-82450912 GGCGGAGCCGAGCGGATTTCCGG + Intergenic
1163336615 19:16676859-16676881 GGCTGAGTCAAGAGAATTGCTGG - Intronic
1164995376 19:32717362-32717384 GGCCTTGTCAACCTAATTTCAGG + Intergenic
940748763 2:157599506-157599528 GGCATTGCCAAGTGAATTTCTGG - Intronic
948758323 2:240172479-240172501 TGCGGTGTGATGGGAATTTCTGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172252761 20:33490868-33490890 GTCGGTGTCAAGCGTTTTACTGG - Intronic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1177288017 21:19076607-19076629 GGCAGTGTGAAGGGAATTTTTGG + Intergenic
1182843020 22:33407258-33407280 GGCTGAGTCAAGAGAATCTCTGG - Intronic
957788304 3:84908567-84908589 GGTGGTTTCATGGGAATTTCAGG - Intergenic
972690414 4:41392015-41392037 GGCATTTTCAAGAGAATTTCAGG - Intronic
978168035 4:105632303-105632325 TGCTGTGTCAAGCGTAGTTCTGG + Intronic
982126347 4:152187080-152187102 TGCAGTGTCAAGGGAGTTTCAGG - Intergenic
992923864 5:81559284-81559306 GGCTGTGTCAGGAGAATTGCTGG + Intronic
996700310 5:126444188-126444210 GGTGGTGGCAAGAGAATTTATGG + Intronic
1003344975 6:5258572-5258594 GGCTGTGTCTTGTGAATTTCAGG - Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1011919274 6:92550647-92550669 GGCATTGTCCAGCGAATTTTAGG - Intergenic
1020212468 7:6166819-6166841 GGCGGTGGCAACCGCATTGCAGG - Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1039339313 8:36629426-36629448 GGCGGTGTTCAGAGAATTGCAGG - Intergenic
1055333606 9:75209139-75209161 GGCGGTGGCAAGAGAATAGCTGG - Intergenic
1055372965 9:75620017-75620039 GGCGGTGACAAGAGAAAATCAGG - Intergenic