ID: 1005484327

View in Genome Browser
Species Human (GRCh38)
Location 6:26285373-26285395
Sequence CGCCGCGACGAGCAAGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 3, 2: 0, 3: 11, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484323_1005484327 10 Left 1005484323 6:26285340-26285362 CCTCATAGATAAGGCCAGAAATT 0: 1
1: 0
2: 2
3: 29
4: 205
Right 1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG 0: 1
1: 3
2: 0
3: 11
4: 37
1005484324_1005484327 -4 Left 1005484324 6:26285354-26285376 CCAGAAATTCGCTTGACACCGCC 0: 1
1: 0
2: 2
3: 6
4: 36
Right 1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG 0: 1
1: 3
2: 0
3: 11
4: 37
1005484321_1005484327 20 Left 1005484321 6:26285330-26285352 CCACGAGTCTCCTCATAGATAAG 0: 2
1: 0
2: 5
3: 7
4: 79
Right 1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG 0: 1
1: 3
2: 0
3: 11
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484327 Original CRISPR CGCCGCGACGAGCAAGGCGC CGG Exonic
901054116 1:6440672-6440694 CGCCGCGAAGTGCATGGCGGTGG - Exonic
902600890 1:17539694-17539716 CGCCGCGTCGCGCACGGCGGCGG + Intergenic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1065190034 10:23199780-23199802 CGCCTCCACCAGCAAAGCGCCGG - Intergenic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1085474846 11:76783317-76783339 CGCCGCGCGGAGAAAAGCGCTGG + Intronic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1107654283 13:42575095-42575117 CGGCGCGACCAGAGAGGCGCGGG + Intronic
1123435540 15:20251485-20251507 CGCAGCCATGAGCCAGGCGCTGG - Intergenic
1150069439 17:62139011-62139033 TGCCGCGGCAAGCAAGGCTCGGG + Intergenic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1165031699 19:33002355-33002377 CGCAGCCATGAGCCAGGCGCCGG - Exonic
1166571294 19:43798678-43798700 CCCCGAGACGTGCTAGGCGCGGG - Intronic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
945148708 2:206765326-206765348 CGCAGCCAAGGGCAAGGCGCAGG + Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1180109751 21:45642513-45642535 CGCCCCGAGGACCAGGGCGCTGG - Intergenic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
961780037 3:129315951-129315973 CGCCGGGAAGAGGAAGGCGAGGG + Exonic
981076594 4:140598534-140598556 CTCCGCCATGAGCAAGGCGCAGG + Intergenic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1018774328 6:166999290-166999312 CGCCCCGACGCGCAGCGCGCTGG - Exonic
1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG + Intronic
1020080272 7:5282936-5282958 CGCGGCGACGAGCACAGCCCAGG - Exonic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1025198654 7:56949270-56949292 CGCGGCGACGAGCACAGCCCAGG + Intergenic
1025673298 7:63627666-63627688 CGCGGCGACGAGCACAGCCCAGG - Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1053643283 9:40107466-40107488 CGCAGAGAAGAGCACGGCGCCGG + Intergenic
1053762869 9:41358024-41358046 CGCAGAGAAGAGCACGGCGCCGG - Intergenic
1054541472 9:66269137-66269159 CGCAGAGAAGAGCACGGCGCCGG - Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1191129781 X:56995451-56995473 CGCCGCCACCAGGAAGGCGGAGG - Exonic