ID: 1005484895

View in Genome Browser
Species Human (GRCh38)
Location 6:26290334-26290356
Sequence CTGAATGCAAAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484895_1005484901 6 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484901 6:26290363-26290385 CTGGCCTATGGCTTGTACTGGGG No data
1005484895_1005484900 5 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484900 6:26290362-26290384 ACTGGCCTATGGCTTGTACTGGG No data
1005484895_1005484904 13 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484904 6:26290370-26290392 ATGGCTTGTACTGGGGGAACCGG No data
1005484895_1005484899 4 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484899 6:26290361-26290383 AACTGGCCTATGGCTTGTACTGG No data
1005484895_1005484902 7 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484902 6:26290364-26290386 TGGCCTATGGCTTGTACTGGGGG No data
1005484895_1005484905 14 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG 0: 5
1: 13
2: 11
3: 24
4: 138
1005484895_1005484906 21 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484906 6:26290378-26290400 TACTGGGGGAACCGGGCCCATGG No data
1005484895_1005484898 -6 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484898 6:26290351-26290373 ATTCAGATTCAACTGGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484895 Original CRISPR CTGAATGCAAAGATGGAACA AGG (reversed) Intergenic
No off target data available for this crispr