ID: 1005484904

View in Genome Browser
Species Human (GRCh38)
Location 6:26290370-26290392
Sequence ATGGCTTGTACTGGGGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484895_1005484904 13 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484904 6:26290370-26290392 ATGGCTTGTACTGGGGGAACCGG No data
1005484894_1005484904 14 Left 1005484894 6:26290333-26290355 CCCTTGTTCCATCTTTGCATTCA No data
Right 1005484904 6:26290370-26290392 ATGGCTTGTACTGGGGGAACCGG No data
1005484893_1005484904 22 Left 1005484893 6:26290325-26290347 CCAGTCGGCCCTTGTTCCATCTT No data
Right 1005484904 6:26290370-26290392 ATGGCTTGTACTGGGGGAACCGG No data
1005484896_1005484904 6 Left 1005484896 6:26290341-26290363 CCATCTTTGCATTCAGATTCAAC No data
Right 1005484904 6:26290370-26290392 ATGGCTTGTACTGGGGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484904 Original CRISPR ATGGCTTGTACTGGGGGAAC CGG Intergenic
No off target data available for this crispr