ID: 1005484905

View in Genome Browser
Species Human (GRCh38)
Location 6:26290371-26290393
Sequence TGGCTTGTACTGGGGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 5, 1: 13, 2: 11, 3: 24, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005484895_1005484905 14 Left 1005484895 6:26290334-26290356 CCTTGTTCCATCTTTGCATTCAG No data
Right 1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG 0: 5
1: 13
2: 11
3: 24
4: 138
1005484893_1005484905 23 Left 1005484893 6:26290325-26290347 CCAGTCGGCCCTTGTTCCATCTT No data
Right 1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG 0: 5
1: 13
2: 11
3: 24
4: 138
1005484896_1005484905 7 Left 1005484896 6:26290341-26290363 CCATCTTTGCATTCAGATTCAAC No data
Right 1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG 0: 5
1: 13
2: 11
3: 24
4: 138
1005484894_1005484905 15 Left 1005484894 6:26290333-26290355 CCCTTGTTCCATCTTTGCATTCA No data
Right 1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG 0: 5
1: 13
2: 11
3: 24
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005484905 Original CRISPR TGGCTTGTACTGGGGGAACC GGG Intergenic
900575654 1:3381127-3381149 GTGCTTGTCCTGGGGGAACGCGG - Intronic
900616403 1:3567535-3567557 TGGCTTGTCCTGGGAGAGCCTGG - Intronic
900639863 1:3683512-3683534 GGGCTTCTACTGGTGGATCCAGG + Intronic
901100009 1:6712678-6712700 TGGTTTGTGCTGCGGGACCCAGG - Intergenic
902083335 1:13836841-13836863 TGGCTACCACTGGGGGAAGCTGG - Intergenic
902756027 1:18549837-18549859 TGCCTTGTCCTGGTGGAAGCTGG - Intergenic
904453664 1:30633326-30633348 TGCTTTGACCTGGGGGAACCAGG + Intergenic
913418130 1:118635229-118635251 TGGCTTGTACTGGAGGATCTGGG - Intergenic
915283881 1:154840872-154840894 TGGCCTGACCTGGGGGATCCGGG - Intronic
916894100 1:169143473-169143495 TGAGTTGTAATCGGGGAACCTGG - Intronic
917891181 1:179439784-179439806 TGGCTCGTACCGGAGGGACCGGG + Intronic
919897600 1:202018748-202018770 TGGCTTCTCCTGGGGGAAGTGGG + Intergenic
920656486 1:207879388-207879410 TGGAAGGTACTGGGGGACCCTGG - Intergenic
923526508 1:234776954-234776976 TGGCCTGTGCTGGGGAAACGTGG - Intergenic
923806242 1:237261324-237261346 TGGATTTTACTGGGGGAAATGGG - Intronic
923830057 1:237545553-237545575 TGGCTTGTGCTGGGTGACCATGG + Intronic
1066792463 10:39080984-39081006 TGGCTCATACTGGGGAAACCCGG + Intergenic
1067095923 10:43299826-43299848 TTGCTCATACTGGGGGAACCAGG + Intergenic
1067327601 10:45284589-45284611 TGGCCTGTACTGGAGGGACCAGG - Intergenic
1067739275 10:48882174-48882196 GGGCATGCCCTGGGGGAACCTGG + Intronic
1070909763 10:80107808-80107830 TGGCTCGTACTGGGGGAACCTGG - Intergenic
1071120420 10:82270426-82270448 TTCCTTGTACTGAGGGCACCTGG + Intronic
1073944302 10:108732117-108732139 TGGCTCATACTAGGGGAACCAGG - Intergenic
1074455042 10:113589138-113589160 TAGCGTGTCCTGTGGGAACCGGG - Exonic
1078667185 11:13335492-13335514 AGGCTTTTACTGGGGGAAGAGGG + Intronic
1078724140 11:13913516-13913538 TAGCTCTTACTGGGGGGACCAGG - Intergenic
1079184015 11:18220549-18220571 TGGCTTCCACTGAGGGTACCAGG + Intronic
1079270816 11:18984072-18984094 TGGCTCGTACTGGGGGAACCAGG - Intergenic
1079389177 11:20006286-20006308 TGGCATGACCTGTGGGAACCTGG - Intronic
1079753632 11:24229031-24229053 TGCCTCGTACTGGGGGAACCCGG - Intergenic
1083164806 11:60877105-60877127 TGGCTTGTACAGGGAGACACAGG + Intergenic
1084438074 11:69155643-69155665 TGACATGTCCTGGGGGAGCCGGG - Intergenic
1084743372 11:71153192-71153214 TGGCTTTTCCTGGGGAAGCCAGG - Intronic
1087266325 11:96065840-96065862 TGCCTTGCACTGGGAGAACATGG + Intronic
1088843087 11:113643101-113643123 AGGCCTGTACTGGGGGCACAGGG - Intergenic
1089263832 11:117242981-117243003 TGGCTTCTACAGGTGGACCCCGG - Intronic
1089504280 11:118953273-118953295 TGGCTTGGAGTAAGGGAACCAGG - Intronic
1089826788 11:121284906-121284928 TGGCTCGTACTGGGGGAACCAGG - Intergenic
1092196913 12:6555357-6555379 TGGCTTGTCGTGGGTGCACCCGG - Exonic
1093260273 12:16928014-16928036 AGGCTTGCCCTGGGGGAGCCAGG - Intergenic
1093348746 12:18071028-18071050 TGGCTCGTACTGGGGGAACCCGG - Intergenic
1093893804 12:24554590-24554612 TGTGTTGTACTGTGGGAAACTGG - Intergenic
1097260615 12:57718042-57718064 TGTGTGGTACTGGGGGACCCAGG - Intronic
1098316956 12:69202832-69202854 TGGCTCATACTGGGGGAACCAGG - Intergenic
1099160617 12:79237031-79237053 TGGATTGTGACGGGGGAACCTGG + Intronic
1099348543 12:81534944-81534966 GGGACTGTACTGGGGGAAGCAGG - Intronic
1104494672 12:129225945-129225967 TGGCTTGTGCTCAGGGATCCTGG - Intronic
1106700605 13:32224307-32224329 TGCCTTGTACTGGAGGATGCTGG + Exonic
1107359151 13:39601181-39601203 TGACTTGTACTGGAGTAATCTGG - Exonic
1107841260 13:44459731-44459753 TGGCTTCCACTGTGGGCACCGGG - Intronic
1109272678 13:60272034-60272056 AGGCTTTTAGTGGGGGAATCAGG - Intergenic
1110866318 13:80399807-80399829 CAGCTCGTACTGGGGGAACCAGG - Intergenic
1111806380 13:93043942-93043964 TGGCTTATAATGGGGGAATCTGG - Intergenic
1115000879 14:28418630-28418652 TGGCTTGTACTGGAGGGACTGGG - Intergenic
1116508419 14:45714323-45714345 CAGCTCATACTGGGGGAACCAGG + Intergenic
1117473148 14:56067077-56067099 TGACTTGGACTGGGGAAACTGGG + Intergenic
1118970283 14:70630840-70630862 TCTCTTGTTCTGGGGGAAGCTGG + Intergenic
1125578020 15:40768224-40768246 TGGCGTGTTCTGGGGGACACAGG - Intronic
1129531417 15:76268357-76268379 TGGCTTGTACTGGGGGAACCCGG - Intronic
1133544989 16:6797472-6797494 AGGCTTGTACTGGGGGAAACAGG - Intronic
1133883866 16:9807744-9807766 GGCCTTGCACTGGGGGAGCCCGG - Intronic
1135224908 16:20647275-20647297 TGGCTCATACTGGGCGAACCCGG - Intronic
1139654336 16:68378160-68378182 TGGCTTTTCCTGCGGAAACCAGG - Intronic
1139690828 16:68641002-68641024 TGGCCCCTACTTGGGGAACCAGG - Intronic
1141248486 16:82332953-82332975 TGACTAGTACTGGGGGAAGGTGG + Intergenic
1143863746 17:9909290-9909312 TGGCTTGGACTGGGAGAAGTGGG - Intergenic
1145039219 17:19564535-19564557 GGGCTGGTACTGGGGCAAACTGG + Intronic
1145126090 17:20301093-20301115 TGGCTTGCCCTGGGGGATGCTGG + Intronic
1146928597 17:36762147-36762169 TGGCTTGGGCTGGGGGAAAGGGG + Intergenic
1147913751 17:43874217-43874239 TGGCTCATACCAGGGGAACCAGG - Intergenic
1150503721 17:65676914-65676936 TGGTTTCAACTGGGGGAGCCTGG + Intronic
1151588827 17:75029742-75029764 TGGCTCGTACTGGGGGAACCCGG - Intergenic
1151871876 17:76841962-76841984 GGGCTTTGGCTGGGGGAACCTGG + Intergenic
1153428714 18:4992455-4992477 TGGCTTCCACTGTGGGCACCAGG + Intergenic
1153499388 18:5732710-5732732 TGGCCTGCTCTGGGGGAGCCTGG - Intergenic
1153608278 18:6855791-6855813 TGGCTTCCACTGTGGGCACCAGG - Intronic
1154078420 18:11229036-11229058 TGGTTTATAATGGGGGAAACAGG + Intergenic
1155300781 18:24426891-24426913 TGGCCAGTGCTGGCGGAACCCGG - Intronic
1157581884 18:48778502-48778524 GGGTTTGTACCAGGGGAACCTGG + Intronic
1159906616 18:74097955-74097977 AGGCTGGTACTGGGGGAAGGAGG - Intronic
1160996373 19:1883953-1883975 TGGCTTGTCTTGAGGGAGCCAGG - Intronic
1161723702 19:5916857-5916879 TGACTTGGCCTGGAGGAACCTGG + Exonic
1161803655 19:6429971-6429993 GGGCTTGAGCTGGGGGAAGCAGG + Intronic
1161811005 19:6471364-6471386 TGGCGGGTAGTGGGGGACCCAGG + Intronic
1162595036 19:11621948-11621970 TGGCTCGTACTGGAGGGACCGGG + Intergenic
1164466137 19:28489205-28489227 TGTCTGCTCCTGGGGGAACCTGG - Intergenic
1165060815 19:33204467-33204489 TGGCTGGGAGTGGAGGAACCAGG + Intronic
1167668821 19:50838409-50838431 TGGGCTGTGCTGGGGGAAGCTGG + Intergenic
1167754050 19:51399888-51399910 TGGCTTGTACTGGGGGAACCAGG + Intergenic
1168576520 19:57516140-57516162 TGGCTCGTACTGGAGGAGCTGGG - Intronic
1168680534 19:58312252-58312274 TGGCTCGTACTGGAGGTAACAGG - Exonic
925030526 2:647262-647284 TGGCTGATACTGGAGGAACCCGG + Intergenic
932069726 2:68607193-68607215 TGGCTTGTACTGGGGGAACCTGG + Intronic
932271433 2:70413505-70413527 TTGCCTGTGCTGGGGGAGCCTGG + Intergenic
934308664 2:91844745-91844767 AGGCTTTTACTGGGGGGACTCGG - Intergenic
935667710 2:105526482-105526504 TGGCTTCTGCTGTGGGCACCGGG - Intergenic
937246789 2:120498961-120498983 TAGCTTGGGCTGGGGGAGCCTGG - Intergenic
937981067 2:127615864-127615886 CAGCTGGTACTGGGGGAACCAGG + Intronic
938620553 2:133048196-133048218 TGGATTGGACTGGGGGAACCTGG + Intronic
938937034 2:136136210-136136232 TAGCTTGCACTGGGGGCTCCTGG - Intergenic
940684413 2:156827872-156827894 ATGCTTGTACTTGGGGACCCAGG - Intergenic
941295822 2:163736752-163736774 TGGCTGGTGCTGGGGGCCCCGGG - Intergenic
942060903 2:172227914-172227936 TGGCTTGTCCAGAGGAAACCAGG + Intergenic
943658909 2:190536591-190536613 TGGCTTGTAGTGGGGAAAAGGGG - Intergenic
945954269 2:216071081-216071103 CAGCTCATACTGGGGGAACCGGG + Intronic
1169604540 20:7302080-7302102 TGTTTTGTACTGGAGGAAGCTGG - Intergenic
1170476802 20:16723025-16723047 ATGCTTGGTCTGGGGGAACCTGG + Intergenic
1172869592 20:38127566-38127588 TGGCTAGTACTGGATGAAGCAGG - Exonic
1174107823 20:48175435-48175457 TGGCTTGGACTGGCCAAACCTGG - Intergenic
1174766638 20:53260546-53260568 TGCCTGGTTCTGGGGGAAGCCGG + Intronic
1175251363 20:57611912-57611934 TGGCGTGGACCGGCGGAACCTGG + Exonic
1180535750 22:16391832-16391854 AGGCTTTTACTGGGGGGACTCGG - Intergenic
1180956064 22:19741907-19741929 TGGCCTGTTCTGGGAGAACCTGG - Intergenic
1181716545 22:24734676-24734698 TGGTTTTTACTGTGAGAACCTGG - Intronic
1182516310 22:30861060-30861082 TCCCTTTCACTGGGGGAACCAGG - Intronic
1184894441 22:47399097-47399119 TGGCTTGGCCTGGGGGTACACGG - Intergenic
950731688 3:14965041-14965063 TGGCATGTGGTGGGGGAAGCCGG + Intronic
950739529 3:15039127-15039149 TGGCTTGTGCTGGTCAAACCTGG - Exonic
951797618 3:26558291-26558313 TAGGTTGTACTGTGGGTACCAGG + Intergenic
952298989 3:32087272-32087294 TGGCTCATACTGGGGGAACCAGG + Intergenic
953004479 3:38965427-38965449 GGGCTTGCACTGGGCGAAGCTGG - Intergenic
953512298 3:43554647-43554669 TGGTTTCTACATGGGGAACCTGG - Intronic
953685376 3:45074099-45074121 GGGCTTGGACTGGGTGAAGCAGG + Intergenic
961647601 3:128400821-128400843 TGGCTTGGGCTGGGGTAATCAGG - Intronic
962386008 3:134933316-134933338 GGGCTTTTACTGGGGGACCCAGG - Intronic
965825354 3:172723884-172723906 TGGCTCATACTGGCGGAACCCGG - Intergenic
969054369 4:4392456-4392478 TTGCTTGTGCTGGGGGCACAGGG + Intronic
970695177 4:18668553-18668575 TGGGTTATACAGGAGGAACCTGG - Intergenic
972884731 4:43471587-43471609 TGGCTCATACTGGGGGAACTCGG - Intergenic
975001512 4:69228414-69228436 TGGCTTGTACATGGAGAACAGGG - Intergenic
975012291 4:69372257-69372279 TGGCTTGTACATGGAGAACAGGG + Intronic
976647751 4:87402945-87402967 TGGCTCATACTGGGGGAACCTGG + Intergenic
978574054 4:110170941-110170963 TGCCTTGGGCTGGGGAAACCAGG - Intronic
983055926 4:163098807-163098829 TGGGTTGGGCTGGGGGATCCAGG + Intergenic
983082193 4:163400256-163400278 TGGCTTGTTTTGGGGGAAAAGGG - Intergenic
984938410 4:184909917-184909939 TGGCTTGTACTGGGGGGACCCGG + Intergenic
986190946 5:5495343-5495365 TGGCTTGGACTCGGGGATCCCGG - Intergenic
986356878 5:6937217-6937239 TGGAATGTGCTGGGGGAGCCAGG + Intergenic
987692276 5:21282642-21282664 TGGTTCATACTGGGGGAACAAGG + Intergenic
987876787 5:23690284-23690306 TGGCTCGTACTGGGGGAACCTGG - Intergenic
987956517 5:24748412-24748434 TGGCTCATACTGGGGGAACCCGG + Intergenic
988933462 5:36059959-36059981 TGGCTTGTACTGGGGGAACCAGG - Intronic
989103286 5:37839548-37839570 TGGCTGGGACTTGGGGCACCTGG - Intronic
991748084 5:69767409-69767431 TGGTTCATACTGGGGGAACAAGG - Intergenic
991892022 5:71346685-71346707 TGGTTCATACTGGGGGAACAAGG - Intergenic
1005484905 6:26290371-26290393 TGGCTTGTACTGGGGGAACCGGG + Intergenic
1005861733 6:29907585-29907607 TGGCAGGTAGTGGGGGAGCCAGG - Intergenic
1005921557 6:30406365-30406387 TGGATTGTACTGGGGGAACCAGG - Intergenic
1006228560 6:32561972-32561994 TGGCCCGTACTGGAGGGACCGGG + Intronic
1010686245 6:78857876-78857898 TGTCTTGTACTGGGGGAACCCGG - Intergenic
1010869430 6:81019895-81019917 TGGCTTCTCCTGGTGGAACAGGG + Intergenic
1014813646 6:125911784-125911806 TGGCTCGTACTGGGGGAACCCGG + Intronic
1015243711 6:131054110-131054132 TGGCTCGTATTAGGGGAACAAGG + Intronic
1018687721 6:166316821-166316843 TGGCTCATACTGGGGGAACCCGG - Intergenic
1018691219 6:166345656-166345678 TGGCTCACACTGGGGGAACCCGG + Intergenic
1020508277 7:9020224-9020246 TGGCTCGTACTCGGGAAACCTGG - Intergenic
1023032514 7:36103059-36103081 TGACCTGCACTGGAGGAACCTGG + Intergenic
1024685881 7:51744670-51744692 TGGCTTTCAGTGGGGAAACCCGG - Intergenic
1032896895 7:136261391-136261413 CGGCTTGTACTGGGGGAACCCGG + Intergenic
1033086291 7:138345090-138345112 TGGCTCATACTGGGGGAACCAGG - Intergenic
1034369881 7:150585598-150585620 TGGCTCACACTGGGGGAACCAGG - Intergenic
1034747242 7:153533810-153533832 TGGCTTTTCCTGGGAGAAGCTGG - Intergenic
1034786066 7:153926776-153926798 TGTATTTTTCTGGGGGAACCAGG - Intronic
1036179175 8:6568346-6568368 CGGATTGCTCTGGGGGAACCTGG - Intronic
1036493014 8:9245092-9245114 AGGCTGGTAGTGGGGGAAGCAGG + Intergenic
1036764266 8:11537255-11537277 TGGTTTGTACTGGGAGAATTTGG + Intronic
1038125309 8:24666868-24666890 TCCCATGTACTGGGGGGACCCGG - Intergenic
1039518228 8:38150648-38150670 TGCCTCTTACTGGGTGAACCTGG - Intronic
1041274507 8:56143141-56143163 TGGCTTCCACTGTGGGCACCAGG - Intergenic
1041403089 8:57465141-57465163 TGGCTCGTACTGGGGTAACAAGG - Intergenic
1042794095 8:72641124-72641146 TGGATTGTAAAGAGGGAACCTGG - Intronic
1045379625 8:101610391-101610413 GGGCTTGAACTGGGGGACCCTGG + Intronic
1045888135 8:107123586-107123608 TGGCTTCCACTGTGGGCACCAGG - Intergenic
1046686602 8:117234751-117234773 TTGCTTGCTCTGGGGGAAGCTGG + Intergenic
1048983184 8:139714300-139714322 TGGGCTGTACTGTGGGAACGTGG - Intergenic
1049312632 8:141941433-141941455 TGGCTGGTCCAGGGGGAGCCTGG + Intergenic
1049357719 8:142196902-142196924 TGGCTTGTGCTAGGAGACCCTGG - Intergenic
1052528810 9:29655934-29655956 TGGCTCTTACTGGGGGAACCTGG + Intergenic
1052538335 9:29776345-29776367 TGGCTCATACTGGGGGAACCTGG + Intergenic
1060824500 9:126680148-126680170 TGGCCTGGGCTGGGGGCACCAGG - Intronic
1187023881 X:15412617-15412639 GGGCTTGTCCTGGGAGAACAGGG - Intronic
1187656725 X:21483898-21483920 TGCATTGTACTGGGGGAACAAGG - Intronic
1190722296 X:53159715-53159737 TGGCTCGTACCGGAGGGACCGGG + Intergenic
1192251719 X:69418860-69418882 TGGATTTTACTGGGGCAGCCTGG + Intergenic
1192594945 X:72396376-72396398 TGGGGTGTAATGGGGAAACCAGG + Intronic
1192770189 X:74180968-74180990 TGGCTCGTACCGGAGGGACCGGG - Intergenic
1195967584 X:110442803-110442825 TGGCTATTGCTGGGGGAAGCAGG - Intronic
1196663738 X:118294874-118294896 TGGCTTGTATTGGGGGAACCCGG + Intergenic
1198344520 X:135746607-135746629 TGGCTCGTACTGGGGGAACCTGG - Intergenic
1200111905 X:153744710-153744732 AGGCTTTTACTGGGGGGACTGGG - Exonic
1201147095 Y:11070948-11070970 TGGCTTTTCCTGGGGAAGCCAGG - Intergenic