ID: 1005490630

View in Genome Browser
Species Human (GRCh38)
Location 6:26344077-26344099
Sequence GGTATGGTGAGGAGTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005490630_1005490640 21 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490640 6:26344121-26344143 GAGGCAGAATGGCAATCCCCGGG No data
1005490630_1005490638 10 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490638 6:26344110-26344132 TAAAAGAAAGGGAGGCAGAATGG No data
1005490630_1005490641 25 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490641 6:26344125-26344147 CAGAATGGCAATCCCCGGGCAGG No data
1005490630_1005490634 -2 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490634 6:26344098-26344120 CCCAAACTCTCATAAAAGAAAGG No data
1005490630_1005490636 -1 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490636 6:26344099-26344121 CCAAACTCTCATAAAAGAAAGGG No data
1005490630_1005490637 2 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490637 6:26344102-26344124 AACTCTCATAAAAGAAAGGGAGG No data
1005490630_1005490639 20 Left 1005490630 6:26344077-26344099 CCATCTGGACTCCTCACCATACC No data
Right 1005490639 6:26344120-26344142 GGAGGCAGAATGGCAATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005490630 Original CRISPR GGTATGGTGAGGAGTCCAGA TGG (reversed) Intergenic
No off target data available for this crispr