ID: 1005495390

View in Genome Browser
Species Human (GRCh38)
Location 6:26383528-26383550
Sequence CCGGTTTCTTCAGTTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005495390_1005495400 10 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495400 6:26383561-26383583 GAGAAGTGGGAAGAGGAAGGAGG 0: 1
1: 1
2: 28
3: 298
4: 2347
1005495390_1005495398 7 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495398 6:26383558-26383580 CCCGAGAAGTGGGAAGAGGAAGG 0: 1
1: 0
2: 2
3: 38
4: 425
1005495390_1005495396 3 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495396 6:26383554-26383576 GTGGCCCGAGAAGTGGGAAGAGG 0: 1
1: 0
2: 3
3: 23
4: 268
1005495390_1005495394 -4 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495394 6:26383547-26383569 CCGGACTGTGGCCCGAGAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 92
1005495390_1005495395 -3 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495395 6:26383548-26383570 CGGACTGTGGCCCGAGAAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1005495390_1005495401 17 Left 1005495390 6:26383528-26383550 CCAGGGACAACTGAAGAAACCGG 0: 1
1: 1
2: 1
3: 7
4: 98
Right 1005495401 6:26383568-26383590 GGGAAGAGGAAGGAGGAAAACGG 0: 1
1: 2
2: 29
3: 493
4: 3402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005495390 Original CRISPR CCGGTTTCTTCAGTTGTCCC TGG (reversed) Intronic
900746990 1:4367227-4367249 CCTGTTACATTAGTTGTCCCGGG + Intergenic
906323287 1:44829524-44829546 CCTGTTTCTCCAGCTGGCCCAGG - Exonic
907907464 1:58796784-58796806 CAGGTGTCTTGAGTAGTCCCAGG + Intergenic
908952152 1:69573955-69573977 GCAGTTTCTTCAGTTGTGCCAGG + Intronic
911252281 1:95590657-95590679 CCAACTTCTTCTGTTGTCCCAGG - Intergenic
911707031 1:101025898-101025920 CGGGTTTCTTCAGTGGAGCCGGG - Intronic
913645502 1:120850525-120850547 CTGGTTTGTTCAGTGCTCCCAGG - Intergenic
914081226 1:144413012-144413034 CTGGTTTGTTCAGTGCTCCCAGG + Intergenic
914176135 1:145281552-145281574 CTGGTTTGTTCAGTGCTCCCAGG + Intergenic
914530861 1:148523037-148523059 CTGGTTTGTTCAGTGCTCCCAGG + Intergenic
914997868 1:152560719-152560741 AGGGTTTCTTCAGTAGACCCTGG + Intronic
915443759 1:155962815-155962837 CCTGTTTCTCCAGCTCTCCCTGG + Intronic
917805955 1:178613886-178613908 CCCCTCTCTTGAGTTGTCCCAGG - Intergenic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
919096919 1:193049086-193049108 CGGGTCTCTTCAGGTTTCCCAGG + Intronic
919364480 1:196639640-196639662 CCTGTTTCAGCAGTTGTCCAAGG - Intergenic
923255179 1:232215786-232215808 CATCTTTCTTCAGTTGGCCCTGG - Intergenic
1063128085 10:3152771-3152793 CCGGTTTCCCCCGTGGTCCCTGG + Intronic
1066686213 10:37983910-37983932 CTGGTTTCTTCAGTTGTTTTAGG - Intergenic
1067666642 10:48284960-48284982 CATGTCTCTTCAGTTCTCCCAGG + Intergenic
1067748847 10:48956934-48956956 CCGGTTCCTTCATTAGTCTCTGG - Intronic
1070959507 10:80488745-80488767 CCCGTTTCTTCTGTTGGCTCTGG + Intronic
1072532698 10:96334465-96334487 CCTGTTTCTCCTGTTTTCCCAGG + Intronic
1072779948 10:98242719-98242741 CTGGTTTCTTCATTTTTCCTTGG + Intronic
1073501639 10:103943940-103943962 CTGGTTTATTCATCTGTCCCTGG + Intergenic
1076194399 10:128506116-128506138 CCAGTGTCCTCAGTTGTCTCAGG + Intergenic
1081615096 11:44586127-44586149 AGGGTTTCTTCAGTTCTCCAGGG - Intronic
1082109865 11:48262638-48262660 GAGGTTTCATCACTTGTCCCAGG + Intergenic
1082969182 11:59001104-59001126 CCAATTTCTTTAGTTGTCTCTGG - Intronic
1083714202 11:64566507-64566529 CAGGATTCCTCAGTTCTCCCAGG + Intronic
1089770275 11:120797449-120797471 CATGCTTCTTCAGTAGTCCCAGG - Intronic
1095855495 12:46855774-46855796 TCAGTTTCTCCAGTTGTGCCCGG + Intergenic
1098369990 12:69748284-69748306 CTGATTTCTTGAGTTGTCCTAGG + Intronic
1100922055 12:99499301-99499323 CCAGTTTGCTCAGTTGACCCAGG - Intronic
1104308174 12:127629232-127629254 ACGGTTTCTGCAGTGTTCCCTGG + Intergenic
1110233957 13:73196950-73196972 CCAGTGTCTTCAGGTGTCCAGGG + Intergenic
1111425980 13:88082916-88082938 CTGGTTGCTTCACTTTTCCCTGG - Intergenic
1113609191 13:111631319-111631341 CAGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609200 13:111631360-111631382 CAGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609210 13:111631401-111631423 CAGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609220 13:111631442-111631464 CAGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609247 13:111631565-111631587 CGGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609258 13:111631606-111631628 CGGGTCTCTGCAGCTGTCCCAGG - Intronic
1113609289 13:111631729-111631751 CAGGTCTCTGCAGCTGTCCCAGG - Intronic
1119212834 14:72845677-72845699 CCTGTCTCTTCTGTGGTCCCAGG - Intronic
1122409227 14:101517618-101517640 CTCCTCTCTTCAGTTGTCCCGGG + Intergenic
1136119237 16:28119682-28119704 AAAATTTCTTCAGTTGTCCCAGG - Intronic
1137470163 16:48747166-48747188 GCAGTTTCTTCAGTTGTAACTGG + Intergenic
1137894180 16:52193581-52193603 CCTGTGTGTTCAGTTGCCCCAGG - Intergenic
1140484459 16:75282743-75282765 CCGGTGTCCTGAGTTGTCCCTGG - Intergenic
1141932034 16:87211967-87211989 CCAGTTTCTTCAGTTCTACTTGG - Intronic
1145928350 17:28664999-28665021 ACAGTATCTTCAGTTTTCCCTGG + Intronic
1147455202 17:40533397-40533419 CCTGGTTCTTCAGTTTTTCCTGG + Intergenic
1149010213 17:51848642-51848664 CCTGTGACTCCAGTTGTCCCAGG - Intronic
1150133397 17:62681049-62681071 CTGGCTTCTCCAGTTCTCCCGGG + Exonic
1162772007 19:12954662-12954684 CCTGTTTCTTCACTTGTCAAGGG - Intronic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
926180723 2:10640862-10640884 CTGGTTTCTTCAGTTAACCTTGG - Intronic
934720802 2:96574868-96574890 CTGGTTTCTGCAGTTCCCCCTGG - Intergenic
934781202 2:96970768-96970790 CCTGTTTCTCCAGTTTTCCTGGG - Exonic
935333419 2:101994179-101994201 CCGGGGTCTTCAGTTGGCCTGGG + Intronic
935553958 2:104486531-104486553 CCCATGTCTTCAGTTTTCCCAGG + Intergenic
937422888 2:121773224-121773246 TCGCTTTCTTCAGCTGTTCCCGG + Intergenic
939829272 2:147053287-147053309 ACGGTTTCTTGAGTCGTTCCTGG - Intergenic
947718295 2:232352618-232352640 CCGCTGCCTTCACTTGTCCCGGG - Intergenic
1169572501 20:6922073-6922095 ACAGTTTCTTCATTTTTCCCTGG + Intergenic
1169803869 20:9539598-9539620 CAGGTTTCTTCAGTGCTCCGGGG - Exonic
1173809906 20:45949332-45949354 CCCGTTCCTTCAGGAGTCCCAGG - Exonic
1174124209 20:48290773-48290795 CCAGTTTCCTCATCTGTCCCAGG - Intergenic
1178929695 21:36806776-36806798 TGGGTTTCTTAAGTTGTCTCGGG - Intronic
1179873308 21:44254646-44254668 CCACATGCTTCAGTTGTCCCGGG + Exonic
955148684 3:56345462-56345484 CCATTTTCCTCAGTTGTCCCAGG - Intronic
955349521 3:58183514-58183536 CCCATTTCTCCTGTTGTCCCTGG - Intergenic
958467238 3:94473049-94473071 CCAGTGACTTCAGTTGTCCTAGG + Intergenic
960631847 3:119740262-119740284 CTGGTTTCTTCAGATGACCCTGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
964483783 3:157166339-157166361 CTTGTCTCTTCAGTTGTCACTGG - Intergenic
972823103 4:42724736-42724758 CCAGGTTGTTCAGTTCTCCCAGG - Intergenic
973015126 4:45128567-45128589 CAGGTTTCTCCAGTTGTTCCAGG + Intergenic
977150024 4:93499592-93499614 CCGGTATCTTCCATTTTCCCAGG + Intronic
989814057 5:45713700-45713722 CCGGTTTCTTCCACTCTCCCTGG - Intergenic
991912544 5:71576049-71576071 TAGTTTTCTTGAGTTGTCCCAGG - Intergenic
1001934615 5:175695295-175695317 TCGGTTTCTTCACTTGTCAAAGG + Intergenic
1004851130 6:19700225-19700247 CCGTTTTCTTCATTCTTCCCAGG + Intergenic
1005495390 6:26383528-26383550 CCGGTTTCTTCAGTTGTCCCTGG - Intronic
1005500074 6:26421826-26421848 CCGGTTTCTTCAGTTGTCGCTGG - Intergenic
1005504551 6:26458344-26458366 GCAGTTTCTTCAGTTGTCGCTGG - Intronic
1013315814 6:108941702-108941724 CCCGGTTCTTCAGTTGTGCTTGG + Intronic
1016206366 6:141472689-141472711 CAGATGTCTTCAGTTGCCCCAGG + Intergenic
1028146982 7:87329646-87329668 CAGATGTCTTCAGTTGCCCCAGG + Intergenic
1031109798 7:117594539-117594561 CCTGTTTCTTCAGGGGTCCATGG - Intronic
1033187838 7:139245619-139245641 CCTGTTTGTTTAGTTTTCCCAGG + Intronic
1034459711 7:151191673-151191695 CCAGCTTCACCAGTTGTCCCAGG + Exonic
1034865501 7:154638125-154638147 CTGGTTCCTGCAGTTGACCCTGG + Intronic
1034980826 7:155475161-155475183 CCAGCTTCTTCAGTGGCCCCAGG + Intronic
1037476382 8:19261992-19262014 CTGGTTCCTTCATTTCTCCCTGG + Intergenic
1043408094 8:79960311-79960333 CTGGTTTCTACAGTTGTCCCAGG + Intronic
1054196591 9:62037982-62038004 CCGATTTCATCAGTTAGCCCAGG - Intergenic
1054641814 9:67550703-67550725 CCGATTTCATCAGTTAGCCCAGG + Intergenic
1054988872 9:71297751-71297773 CAAGTTCCTTCAGTTGCCCCAGG + Intronic
1059775777 9:117474063-117474085 CCTGTTTCGTCAATTGTCCAGGG + Intergenic
1186952249 X:14639575-14639597 CTGGTTTTGACAGTTGTCCCTGG - Intronic
1189569487 X:42280478-42280500 CTAGTTTCTTAAGTTGTTCCAGG - Intergenic
1198525630 X:137497548-137497570 CTGGTGGCTTCAGTTGTCCAGGG - Intergenic
1202167108 Y:22001320-22001342 CCGGTTTCTTCTGCAGTCCTGGG - Intergenic
1202224252 Y:22585053-22585075 CCGGTTTCTTCTGCAGTCCTGGG + Intergenic
1202318862 Y:23610607-23610629 CCGGTTTCTTCTGCAGTCCTGGG - Intergenic
1202551907 Y:26059450-26059472 CCGGTTTCTTCTGCAGTCCTGGG + Intergenic