ID: 1005496603

View in Genome Browser
Species Human (GRCh38)
Location 6:26393053-26393075
Sequence TTACGTGACCAGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005496603 Original CRISPR TTACGTGACCAGAGGGGAGG AGG (reversed) Exonic
904672088 1:32173632-32173654 TTACATGGCCAAAGGAGAGGAGG - Exonic
905671258 1:39791758-39791780 TAAGGAGACCAGTGGGGAGGAGG - Intergenic
907544672 1:55249370-55249392 TTTAGTGAAAAGAGGGGAGGTGG - Intergenic
912707513 1:111925926-111925948 TTTTGTGATCAGTGGGGAGGGGG - Intronic
912955239 1:114151163-114151185 TTAGGTGACCAGAGGGTCTGGGG - Intronic
917978701 1:180256226-180256248 CAACGTGACCAGATGGGCGGAGG - Intronic
923225017 1:231931154-231931176 TTAGTTGACCAGAGGGGAGCAGG + Intronic
924859698 1:247908459-247908481 TTATGGGACCAGAGAAGAGGTGG + Intergenic
1063152295 10:3347691-3347713 TTAGGTGCCCAGATGAGAGGAGG - Intergenic
1064293725 10:14058653-14058675 TTACATGACCAGAGGGAGGTTGG + Intronic
1065553371 10:26890735-26890757 GTACATGGCCAGAGGGGCGGAGG - Intergenic
1067568377 10:47354131-47354153 TTACAGAAACAGAGGGGAGGTGG - Intronic
1069175123 10:65280842-65280864 TTAAGTGAGGAGATGGGAGGAGG + Intergenic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1070387462 10:75938929-75938951 CTCCGTGCCCAGAGGCGAGGAGG + Intronic
1071176707 10:82934741-82934763 TTACCTAAACAGAGGGCAGGAGG - Intronic
1073893344 10:108124938-108124960 GTAAGTGATCAGTGGGGAGGTGG - Intergenic
1075182518 10:120224818-120224840 TTACGTGACCAAAGGGAATAAGG - Intergenic
1081997576 11:47375223-47375245 TGACGAGAACAGAGAGGAGGAGG + Intronic
1084415767 11:69032192-69032214 TTTCCTGACCATAGGGGAGGGGG + Intergenic
1086136656 11:83448678-83448700 TTATGTGACAATGGGGGAGGGGG - Intergenic
1089733939 11:120536840-120536862 TTACGTAAACAGAGCGGGGGAGG + Intronic
1090523213 11:127501032-127501054 TTACGAGGCCAGAGGAGAAGAGG - Intergenic
1090883250 11:130853274-130853296 TTACATGATCAGAGGGAAAGAGG - Intergenic
1091814152 12:3423616-3423638 TTACCTGACCAGTGGGCAGGTGG - Intronic
1096257491 12:50072334-50072356 GAAGGTGACCCGAGGGGAGGAGG - Intronic
1099724656 12:86410947-86410969 TTACATGGCCAGAGCAGAGGAGG - Intronic
1100127179 12:91441477-91441499 TTACAGGACCAGAAAGGAGGTGG + Intergenic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1104689369 12:130813781-130813803 TGAAGTGACCAGAAGGGAAGGGG + Intronic
1114664312 14:24369065-24369087 AACCGTGGCCAGAGGGGAGGGGG - Intronic
1115480050 14:33851710-33851732 ATACATGAACAGATGGGAGGAGG + Intergenic
1118705002 14:68472224-68472246 GGACATGACCAGAGGAGAGGTGG - Intronic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1122193338 14:100065626-100065648 GTCCATGACCAGAGGGCAGGGGG + Intronic
1123891627 15:24786287-24786309 TTACGTGACCAATGAGAAGGGGG + Intergenic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1128993666 15:72280916-72280938 TTAGGTAACTAGAGGGCAGGAGG + Intronic
1129192340 15:73944774-73944796 TTAACTGAACAGAGGGAAGGAGG + Intronic
1130141688 15:81231268-81231290 TGAGGAGACCAGAGGAGAGGAGG + Intronic
1132203293 15:99969737-99969759 GTTCATGACCAGAGGTGAGGTGG + Intergenic
1137836977 16:51601645-51601667 TTACGAAACCTGAAGGGAGGAGG + Intergenic
1139535968 16:67574044-67574066 TTACGTGACCAAAGATGGGGTGG + Intronic
1139927833 16:70501175-70501197 TTATGGGCCCAGTGGGGAGGGGG - Intronic
1143482271 17:7234520-7234542 TCACGTGACATGAGGAGAGGTGG - Exonic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1146684754 17:34834199-34834221 TTACGGGGCCGGTGGGGAGGTGG - Intergenic
1146948684 17:36891037-36891059 TTATGTGGCCAGGGGGCAGGGGG + Intergenic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148690163 17:49522584-49522606 TAAGGTGACCAGAGGAGAAGAGG + Intergenic
1149551017 17:57539770-57539792 ATCCAAGACCAGAGGGGAGGAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150648390 17:66994041-66994063 TTAAGAGACCAGAGGTGCGGTGG + Intronic
1152196919 17:78923875-78923897 TCACCTGCCCAGAGTGGAGGTGG - Intronic
1152442923 17:80320175-80320197 GTGGGTGACTAGAGGGGAGGAGG - Intronic
1155440988 18:25862574-25862596 TTACAGGAACATAGGGGAGGGGG - Intergenic
1155572760 18:27213393-27213415 TTTCCTGGCCAGAAGGGAGGTGG - Intergenic
1157722326 18:49934829-49934851 TTACATGACCAGAGTGTAGAAGG + Intronic
1164753321 19:30671625-30671647 CTCAGTGACCAGAGGTGAGGAGG + Intronic
1164988433 19:32666726-32666748 TTACTTGATCACAGGGGTGGAGG - Intronic
1166075867 19:40413462-40413484 TGACGTCACCAGAGGGTGGGTGG + Intergenic
926306573 2:11641376-11641398 TCACTTGACTAGAGAGGAGGTGG + Exonic
926553671 2:14331572-14331594 TCACGTGACCTGAGAGGATGTGG + Intergenic
927073738 2:19555788-19555810 TTCTGAGACCAGAGGTGAGGAGG + Intergenic
935686344 2:105687456-105687478 TGATGTGACCAGAGGTGGGGAGG - Intergenic
938113092 2:128582105-128582127 TCACGGGAACAGAAGGGAGGTGG - Intergenic
940807925 2:158208600-158208622 TCATGAGACCACAGGGGAGGAGG + Intronic
947874185 2:233457645-233457667 TTAGGTGGGCAGAGGAGAGGGGG + Intronic
948722348 2:239908947-239908969 TTAGCTGCCCAGAGGGGATGCGG - Intronic
949028540 2:241777467-241777489 TTCTGTAAACAGAGGGGAGGTGG + Intronic
1170592451 20:17781229-17781251 TTACGTGACCTGAGGGTCCGTGG - Intergenic
1172944277 20:38675318-38675340 TTCCGTGACCATATGGGCGGGGG + Intergenic
1174346404 20:49933373-49933395 TTGCGTGACCAAAGAAGAGGAGG + Intergenic
1177765298 21:25450438-25450460 TTACAGGCCCAGAGGAGAGGAGG - Intergenic
1182430309 22:30295226-30295248 TCACGTGCCCAGAAGGAAGGAGG + Intronic
1183772137 22:39936008-39936030 TTAAGTGAACAGAAGGGAAGAGG + Intronic
1184540841 22:45123241-45123263 TTATCTGTCCAGAGGGGAGAAGG + Intergenic
949371358 3:3338000-3338022 TTGCGTGACCAGATGGTAGAGGG - Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
951823304 3:26838398-26838420 CTATGTGACGAGAGAGGAGGGGG + Intergenic
953069670 3:39506565-39506587 TTATCTTACCAGAGGGGTGGAGG + Intronic
953197321 3:40746627-40746649 GTATGTGCCCAGTGGGGAGGAGG + Intergenic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
961215266 3:125154858-125154880 CTACGTGACGAGAAGTGAGGCGG + Intronic
965755004 3:172016774-172016796 TTAGGTGAACAGAGAGGATGAGG - Intergenic
967434961 3:189432610-189432632 TTACATCATCAGAGGGGTGGGGG + Intergenic
968294066 3:197559979-197560001 GTACCTGAACAGAGAGGAGGTGG - Intronic
969561208 4:7949628-7949650 TGACGGGGGCAGAGGGGAGGCGG - Intergenic
970170030 4:13280256-13280278 TTCCGTGATCTGAGGAGAGGTGG - Intergenic
971365950 4:25977308-25977330 TTACATGACTGGAGTGGAGGAGG + Intergenic
973204019 4:47539849-47539871 TTCAGTGACTAGAGTGGAGGAGG - Intronic
973708388 4:53601956-53601978 TCACGTGAGCAGGGGTGAGGAGG - Intronic
975318259 4:72979938-72979960 TTACATAATCAGTGGGGAGGAGG - Intergenic
975536818 4:75459793-75459815 TTTGGTGACCAGAGGGGAATAGG + Intergenic
977790786 4:101099998-101100020 TTATGTGACCTGAGGAGAGTGGG + Intronic
992390854 5:76329517-76329539 TTAAGAGATCAAAGGGGAGGTGG + Exonic
994566602 5:101454551-101454573 TTACGTGCACAAAGAGGAGGGGG - Intergenic
999802810 5:155053545-155053567 TTAAGTGACAAGAGGAGAAGAGG + Intergenic
1005461625 6:26074791-26074813 TTACCTGCCCAGAAGGGAAGAGG - Intergenic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005995022 6:30925716-30925738 GCAGGTGACCAGAGGGGATGGGG + Exonic
1007661967 6:43492341-43492363 GTACTTGCCCAGAGGGGTGGCGG + Intronic
1008264583 6:49409172-49409194 TTCCCAGACCAGAGGGGTGGAGG - Intergenic
1011379763 6:86730505-86730527 ATACCTGACCTGAGGGGAGGTGG + Intergenic
1012709580 6:102582145-102582167 TTAGTTGAGGAGAGGGGAGGAGG - Intergenic
1017137582 6:151161796-151161818 TTATGTTAACAGAGGGGAGATGG + Intergenic
1018818874 6:167357658-167357680 GTCGGTGACCAGAGGGGAGCAGG + Intronic
1019364925 7:628375-628397 TTAGGTCAGCAGAGGGCAGGCGG + Intronic
1020342882 7:7131544-7131566 TCACCTGACCTGAGGTGAGGAGG + Intergenic
1027441591 7:78224968-78224990 TGAGGTGAGCAGAGGGAAGGCGG - Intronic
1029312220 7:99677980-99678002 TTACTCTACCAGAGGGGAGCTGG - Intronic
1032530522 7:132615882-132615904 TTAAGTCTCCAGAGGGGAGAAGG - Intronic
1033255780 7:139800151-139800173 TGACGGGGCCAGAGGGGAGCAGG - Intronic
1033678121 7:143564474-143564496 TTAGTTTTCCAGAGGGGAGGAGG - Intergenic
1033691175 7:143739328-143739350 TTAGTTTTCCAGAGGGGAGGAGG + Intergenic
1033693718 7:143764970-143764992 TTAGTTTTCCAGAGGGGAGGAGG + Intergenic
1036607321 8:10319026-10319048 TCACGTGATCAGTGGGGAAGGGG - Intronic
1040633051 8:49238717-49238739 TTATGTCACCAGGTGGGAGGTGG + Intergenic
1045276124 8:100707454-100707476 TTACGTGTCCACTGGAGAGGGGG + Intronic
1048180668 8:132191741-132191763 TGAGCTGACCAGAGAGGAGGAGG + Intronic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1049133834 8:140875457-140875479 TGATGTCACCAGAGTGGAGGAGG + Intronic
1049850093 8:144826414-144826436 TTAGATGACCAGAGAGGATGTGG + Intergenic
1050962894 9:11758956-11758978 TCACTTGACCAGGGAGGAGGAGG + Intergenic
1052300763 9:26949984-26950006 TTACGTGACTCCAGGGCAGGAGG + Intronic
1055010117 9:71556090-71556112 TTACGTGGGCAGGGGGGTGGGGG - Intergenic
1061260029 9:129475118-129475140 TTCTGTTACCAAAGGGGAGGTGG - Intergenic
1185457116 X:316797-316819 TTGCGGGGCCAGAGGGGAAGCGG - Intronic
1199712268 X:150477730-150477752 TTAGGTGGGCAGAGAGGAGGGGG + Intronic
1199870325 X:151892608-151892630 TTACATGACCAGAAGTGAGCAGG - Intergenic