ID: 1005498212

View in Genome Browser
Species Human (GRCh38)
Location 6:26407320-26407342
Sequence TAACTTGCAGGAAGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005498212_1005498219 9 Left 1005498212 6:26407320-26407342 CCTGGCTTCCTTCCTGCAAGTTA 0: 1
1: 0
2: 1
3: 21
4: 270
Right 1005498219 6:26407352-26407374 TGGCTGCATTGCCTTGCTGAAGG 0: 3
1: 0
2: 0
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005498212 Original CRISPR TAACTTGCAGGAAGGAAGCC AGG (reversed) Intronic
900151128 1:1179799-1179821 GAACCTGCCGGCAGGAAGCCTGG + Intronic
900512291 1:3066472-3066494 TGCCTTGCAGGTAGGCAGCCCGG + Intergenic
901909144 1:12440578-12440600 TAAAGTGAAGGAAGGAGGCCAGG + Intronic
902157900 1:14504496-14504518 TGAATTGCAGAAAGGAAGCCAGG + Intergenic
903027446 1:20439454-20439476 TAGGCTGCAGGAAGAAAGCCTGG - Intergenic
904302316 1:29562103-29562125 TAACTTGGAGGAGGGCAGCCAGG - Intergenic
904401108 1:30257420-30257442 CAACTTGGAGGAGGGCAGCCAGG + Intergenic
904858798 1:33519788-33519810 TACCGTGCAGGAAGGAGGCAGGG - Intronic
906930051 1:50160360-50160382 TAACTTGCAGGTAGGAAATAAGG - Intronic
907021638 1:51072155-51072177 GGACTTGAAGGCAGGAAGCCTGG - Intergenic
909055283 1:70813710-70813732 AAACTTACAGGAAGGAAGAGAGG + Intergenic
915149527 1:153818964-153818986 TCTCTTGCAGGAAGGAATTCTGG - Intronic
918825588 1:189319625-189319647 TTACTTACAGAAAGGCAGCCAGG - Intergenic
919010233 1:191950575-191950597 TAACTTGCAGGGAGGTATTCTGG - Intergenic
919497122 1:198286856-198286878 TAAAAGGGAGGAAGGAAGCCAGG - Intronic
919784951 1:201253097-201253119 GGACAAGCAGGAAGGAAGCCTGG - Intergenic
922452166 1:225746157-225746179 TCTCTTGGAGGAAGGAGGCCTGG - Intergenic
922703544 1:227776386-227776408 GAACTGGCTGGAAGGAAGGCTGG + Intronic
923097521 1:230787443-230787465 AAAATAGCAGGAAAGAAGCCAGG - Intronic
924543377 1:245002294-245002316 TAACTGGAAGGAAGCAAGGCTGG - Intronic
924599832 1:245478777-245478799 TGAGTAGCAGGAAGGAAACCAGG + Intronic
924874640 1:248089148-248089170 TAACTGGCTGGAACGAAGCATGG + Intronic
1064850812 10:19706879-19706901 TAGGTTGCAGGAAGGAATCCAGG - Intronic
1067082970 10:43221900-43221922 CAACTTGCAGGCAGGAGGCCTGG - Intronic
1067172571 10:43920494-43920516 GAACTTCCAGGCAGCAAGCCTGG - Intergenic
1068428485 10:56899784-56899806 TAAAATGCAGAAAGGAAGCAGGG - Intergenic
1070807837 10:79281008-79281030 TAACTTGGAGGAGAGAAGCTTGG - Intronic
1070981508 10:80652217-80652239 AACCTTGCAGGGAGGCAGCCAGG + Intergenic
1071170814 10:82861842-82861864 GAGGTTGCAGGAAGGAAACCAGG - Intronic
1072673042 10:97445812-97445834 TAACTTGGAGGAGGGCAGCCCGG - Exonic
1072920621 10:99574012-99574034 TAACTATCAGGAAGGAAGGAGGG + Intergenic
1073790503 10:106935415-106935437 CATTTTGCAGGTAGGAAGCCAGG - Intronic
1073809412 10:107136284-107136306 TCACTTGTATGAAGAAAGCCAGG - Intronic
1074365533 10:112854848-112854870 TGAGCTGCAGGAAGGAAGACGGG - Intergenic
1075485718 10:122820574-122820596 TAAGTTGAAGAAAGGGAGCCTGG - Intergenic
1077048653 11:556916-556938 TCACCTGCACGAAGGAAGGCAGG + Exonic
1077637398 11:3853026-3853048 GATCTTGGAGGCAGGAAGCCAGG - Intergenic
1077998758 11:7476108-7476130 TCACCTGCAGGGAAGAAGCCAGG + Intergenic
1078401352 11:11030230-11030252 TAACTTACAGTAAAGAAACCTGG - Intergenic
1078559059 11:12354946-12354968 TAACTTGCAGGCTGGCAGGCAGG - Intronic
1078595842 11:12685993-12686015 TAACCAGGAGGAAGGCAGCCAGG - Intronic
1078988280 11:16615408-16615430 TAACTGGCAGAAACTAAGCCAGG + Intronic
1080192551 11:29569544-29569566 AAACTTCCAGGTAGAAAGCCAGG + Intergenic
1080742297 11:35077800-35077822 TGACTCACAGGAAGGAAACCTGG + Intergenic
1081730912 11:45371184-45371206 TATCTTGCAGGAAGGGTGTCAGG - Intergenic
1085540100 11:77259603-77259625 TCACCTGCAGGAAAGAAGCCTGG - Intronic
1085542901 11:77289067-77289089 AAAGTGGAAGGAAGGAAGCCTGG + Intronic
1087220989 11:95546045-95546067 TACCTTGCATGAAGGCTGCCAGG - Intergenic
1087279356 11:96192858-96192880 TAGCTTGCACGAAGCAAACCAGG - Intronic
1089869721 11:121661398-121661420 GAGCTTGCAGGAAAGAGGCCTGG + Intergenic
1089891667 11:121887614-121887636 TAACTTGCAGTCAGTAAGGCTGG + Intergenic
1090654498 11:128832621-128832643 TAACTAGCAGGCAGGCACCCTGG + Intergenic
1091602791 12:1928177-1928199 CAGCTTCCAGGAAGGATGCCTGG + Intergenic
1092297417 12:7211372-7211394 TAAATTTCAGGATGGAATCCTGG - Intronic
1092756875 12:11771867-11771889 TAACTTGGAGTCAGGAAGCCTGG + Intronic
1093399796 12:18731882-18731904 TAACTAGTAGGAGGGAAACCTGG - Intronic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1097684085 12:62676159-62676181 TGACTTGAAGCATGGAAGCCAGG - Intronic
1098627256 12:72687385-72687407 TCATTTGGAGGAAGGAAGCTTGG + Intergenic
1100962801 12:99983230-99983252 CAACTGGGAGGGAGGAAGCCTGG - Intronic
1101582079 12:106050473-106050495 GAACTTGCAGGGAGGGAGCCTGG - Intergenic
1101692482 12:107094285-107094307 TAATTGGCAGGACGGATGCCAGG + Intergenic
1101796821 12:107982644-107982666 TATCTTCCACAAAGGAAGCCTGG + Intergenic
1102395346 12:112581058-112581080 AAACTTGCAGGAAGTAACCAAGG - Intronic
1102628892 12:114259281-114259303 TAGCTGGCAGGTAGGAAGCAAGG + Intergenic
1106605942 13:31228985-31229007 TAACTTCTAGGAAGGAAGCTTGG + Intronic
1106986309 13:35355711-35355733 TGACCTGCAAGAAAGAAGCCAGG - Intronic
1107472749 13:40705571-40705593 TAACTTACAGTAATGAAACCTGG + Intergenic
1107491305 13:40882051-40882073 TAACTTACAGTAATGAAACCTGG + Intergenic
1107821917 13:44293678-44293700 GAAGTTGCTGGAAGGCAGCCTGG - Intergenic
1108321450 13:49294689-49294711 TGACTGGGATGAAGGAAGCCAGG - Intergenic
1109255723 13:60078920-60078942 GAACTTACATGAATGAAGCCAGG + Intronic
1110424187 13:75346719-75346741 TCACTTTCAGGAAGGCAGTCTGG - Intronic
1111018547 13:82414704-82414726 TAAGTTGCAGGAAGGAAAAGGGG + Intergenic
1112759294 13:102675188-102675210 TAATTTGCAGTAAAGAACCCTGG + Intronic
1112883256 13:104135374-104135396 TAACTTGGAAGAGGTAAGCCTGG - Intergenic
1113370462 13:109720345-109720367 TAACTTGGGGGAACAAAGCCTGG - Intergenic
1113718483 13:112533080-112533102 GAGCTTCCAGGAAGGAAGACAGG + Intronic
1114839138 14:26242627-26242649 TAAGTTGCAGGAATGACTCCAGG + Intergenic
1115872132 14:37816457-37816479 TGGCTTCCAGGAAGGAAGCCTGG + Intronic
1118763105 14:68892582-68892604 TAAAAGGCAGGAAGGAAGCCTGG + Intronic
1120832860 14:89013476-89013498 GAACTTCCTGGAAGGAAGGCAGG + Intergenic
1121385669 14:93521540-93521562 TTACTGTCAGGAAGAAAGCCAGG + Intronic
1122851453 14:104534694-104534716 TAAGTTGCAGGAAGCAGCCCTGG + Intronic
1125188343 15:36959264-36959286 TAACTTGCAGGAAAAAAATCTGG - Intronic
1126703246 15:51385785-51385807 TAAGGAGCAGCAAGGAAGCCAGG + Intronic
1129073015 15:72967516-72967538 TAACATGCAAGAAAGCAGCCTGG + Intergenic
1129704381 15:77786077-77786099 TCACTTGCAAGAAGCAAGCAGGG + Intronic
1129890194 15:79066738-79066760 TAACTGTGAGGAAGGATGCCAGG + Intronic
1130825794 15:87544731-87544753 TACCTTGTTGGAAGGAAGCATGG - Intergenic
1131496170 15:92913091-92913113 TAACTTTCAAGCAAGAAGCCTGG - Intronic
1131496699 15:92917895-92917917 TCACTGGCAGGAAGTTAGCCTGG + Intronic
1131954723 15:97721176-97721198 CAAGTTGGAGGAAGGAAGTCAGG + Intergenic
1132222099 15:100112671-100112693 ACACTTGAAGGAAGGAAGCTTGG + Intronic
1132824847 16:1899180-1899202 TAACTTCCAAGAAAGAGGCCAGG + Intergenic
1132908851 16:2298287-2298309 TAAACTGGAGGAAGGGAGCCAGG - Intronic
1133413817 16:5590424-5590446 TAACTTTCAGCAAGGAACTCAGG - Intergenic
1134266754 16:12699589-12699611 AAGCTTGCTGGAAGGAAGCTGGG + Intronic
1135589123 16:23692560-23692582 TACCCTGCAGGAATGAAGCTTGG - Intronic
1138082786 16:54107651-54107673 TAACTGACAGCAAGGAAGCATGG + Intronic
1138900172 16:61259544-61259566 TAACTTGCTCAAGGGAAGCCAGG - Intergenic
1139030458 16:62874927-62874949 TAACTTGCAGGAGACAAGCATGG - Intergenic
1140272339 16:73478384-73478406 AAACTAGCAGGGAAGAAGCCTGG - Intergenic
1141460699 16:84177118-84177140 AGACTTGCAGGCAGGAAGCAGGG + Intronic
1142032814 16:87846886-87846908 TCCCTTGCAGGGAGGAGGCCAGG - Intronic
1144055913 17:11540368-11540390 TAATGTACAGGAAGGTAGCCTGG - Intronic
1144811021 17:17999023-17999045 TAAATATCAGGAAGGAAGGCTGG - Intronic
1145832970 17:27932290-27932312 TACCTAGCTGCAAGGAAGCCTGG - Intergenic
1146653050 17:34618925-34618947 GAACTGGGAGGAAGGATGCCTGG - Intronic
1147033928 17:37665631-37665653 TAACTAGCTGGAAGGAAGTGTGG - Intergenic
1147721378 17:42541675-42541697 TAAGTGGCAGGAAGGAGCCCTGG - Intronic
1150463947 17:65375895-65375917 TAACTTGCAGGCTTGAGGCCTGG - Intergenic
1150697835 17:67421089-67421111 TACCTGGAAGGAAGGAAGCCAGG - Intronic
1153263730 18:3247779-3247801 TAGCAAGCCGGAAGGAAGCCCGG - Exonic
1154212849 18:12394878-12394900 TGACTTGCAGAAGGGAAACCAGG + Intergenic
1155431906 18:25768411-25768433 AGACTTTAAGGAAGGAAGCCAGG + Intergenic
1155826252 18:30446856-30446878 TAAGTTGCATGAAGGTGGCCAGG + Intergenic
1156895000 18:42235837-42235859 TATCTTTCAGGAAAGGAGCCTGG - Intergenic
1157499510 18:48179869-48179891 TTCCTTGCAGGAAGGAAGGGAGG - Intronic
1159336538 18:67075273-67075295 TATGTTGCCGGAAGGAAGGCAGG - Intergenic
1159670301 18:71213075-71213097 TTACTTACAGTATGGAAGCCAGG - Intergenic
1160350461 18:78174118-78174140 TAACTGGCAGGAAGGCTGCTGGG - Intergenic
1161813091 19:6481856-6481878 TAATTAGCAGGCAGGATGCCTGG - Intronic
1162361279 19:10221957-10221979 TAACTTGAAAGAAGAAGGCCGGG + Intronic
1162554558 19:11378678-11378700 TAACTTCCAGGTAGGTGGCCTGG - Exonic
1163110320 19:15156682-15156704 TACCCTGCAGGCAGGGAGCCAGG + Intergenic
1164492839 19:28730070-28730092 TATATTGCAGGAAGAAAGACGGG - Intergenic
1166822344 19:45588117-45588139 AAACTTCCAGGAAGGATCCCAGG - Intronic
1167620363 19:50556880-50556902 GAACGTCCAGGAGGGAAGCCGGG + Intronic
1168695321 19:58400878-58400900 CACCTTGCAGGAGGGACGCCAGG + Intergenic
925908627 2:8556052-8556074 TAACTTGCAGAAAGGCAGAAAGG + Intergenic
926837209 2:17036252-17036274 TAACTAGAAGGAAGGAAGGAAGG + Intergenic
927255623 2:21038156-21038178 CAACTTGCTGGAAGTAAGCTGGG + Intronic
927271524 2:21215208-21215230 TAAATGGCAGGAAGGAAGGAAGG + Intergenic
927719220 2:25372420-25372442 GAAGGTGGAGGAAGGAAGCCAGG - Intergenic
928872332 2:35994923-35994945 TGGCCTACAGGAAGGAAGCCAGG - Intergenic
928943259 2:36749336-36749358 TAGGATGCAGGAAGGAAGACAGG + Intronic
929242572 2:39666786-39666808 CAACTTGAAGGAAGGAGCCCGGG - Intronic
930029106 2:47047596-47047618 CCCCTTGCAGGAAGGGAGCCAGG - Intronic
932957884 2:76376772-76376794 AAAGTTACAGGAAGGAGGCCGGG - Intergenic
934605587 2:95692773-95692795 TTGCTTCCAGGGAGGAAGCCTGG + Intergenic
935582271 2:104766884-104766906 TGTCTGGCAGGAAGGCAGCCGGG + Intergenic
936539053 2:113335313-113335335 TTGCTTCCAGGGAGGAAGCCTGG + Intergenic
936664282 2:114576461-114576483 TGCCTGGCAAGAAGGAAGCCTGG + Intronic
937541890 2:122965947-122965969 TAACCTGAAGGAAGAATGCCTGG + Intergenic
937695040 2:124799570-124799592 AACCTAGCAGAAAGGAAGCCTGG + Intronic
938653332 2:133406571-133406593 AAACTTCCAGGAAGGAAGGAAGG + Intronic
939523736 2:143264993-143265015 TAACTTCTAGGAAGGATGCCAGG + Intronic
939883382 2:147655268-147655290 TATCCTGCAGGAAAGGAGCCTGG - Intergenic
940357495 2:152761339-152761361 AAGCGTGCAGGAAGGAAGGCAGG - Intergenic
941232713 2:162931217-162931239 TGACTTGCAAGAAAGTAGCCAGG - Intergenic
941750399 2:169129720-169129742 TAACTTGCAGGTAGAAGGGCAGG + Intronic
941903497 2:170699307-170699329 TAAGATGCAGAAAGCAAGCCAGG - Intergenic
942321594 2:174741199-174741221 TAACATGCAGGGCAGAAGCCAGG - Intergenic
944852169 2:203731165-203731187 CAACTTGCAGAAGGCAAGCCAGG - Intronic
947868889 2:233421406-233421428 TAAGATGCAGGAAAGAAGGCAGG - Intronic
948355465 2:237373881-237373903 TAACTGGCAGGAAGGCCACCTGG - Intronic
1171347973 20:24480124-24480146 AAACTTGGAGGAAGGATGCTGGG - Intronic
1172004159 20:31806327-31806349 TACTTGTCAGGAAGGAAGCCAGG - Intergenic
1172518806 20:35554279-35554301 TATGTTGCAGGAGGGAAGACTGG - Intronic
1172754669 20:37274708-37274730 TAACTTGCAGGACAGAGGCAGGG + Intergenic
1174113695 20:48213126-48213148 TAAGTTGGAGGATGGAAGCCTGG - Intergenic
1174168164 20:48599414-48599436 TAAGTTGGAGGATGGAAGCCTGG + Intergenic
1174933111 20:54837191-54837213 AAACTTTCATTAAGGAAGCCAGG - Intergenic
1175865614 20:62174753-62174775 TAACGTTCTGGAAGGAACCCTGG - Intronic
1178753646 21:35327361-35327383 TAACATGGAGGAGGGCAGCCAGG - Intronic
1182071546 22:27467163-27467185 TCACCTGCAGGAGGGCAGCCGGG - Intergenic
1182475026 22:30572623-30572645 GAACTAGCAGGAGGGAAGGCAGG + Intronic
1182892213 22:33828482-33828504 CAGCTTGTGGGAAGGAAGCCAGG + Intronic
1183776650 22:39970623-39970645 TAAATTGCAGCAGGGTAGCCGGG + Intronic
1184665170 22:45984852-45984874 TAAGATGCAAGAAGGCAGCCGGG - Intergenic
950681956 3:14591650-14591672 TAACTTTCTGGAAGGGAGCCTGG + Intergenic
953029170 3:39166243-39166265 TGACTCACAGGCAGGAAGCCAGG + Intergenic
954330585 3:49887956-49887978 GTTCTTCCAGGAAGGAAGCCTGG + Intronic
954388467 3:50256682-50256704 TTAGTTCCAGGAAGGGAGCCTGG - Intronic
956106214 3:65821425-65821447 TGACTTCCAGGAAGCATGCCAGG - Intronic
956710779 3:72036861-72036883 TATGTTCCAGCAAGGAAGCCTGG + Intergenic
957525578 3:81374899-81374921 TAACTAGCAGGAAGAAGGCAGGG - Intergenic
957587156 3:82147040-82147062 TAAGTTGCTGCAGGGAAGCCAGG + Intergenic
957955719 3:87184452-87184474 GAAGTTGCAGGAAGAAAGCTGGG - Intergenic
961950143 3:130741091-130741113 GAACTTGCAGGAGGGGAGGCAGG - Intronic
961989374 3:131171250-131171272 TAAATTGAAGAAATGAAGCCAGG + Intronic
963771519 3:149391106-149391128 TCACTTGAGGCAAGGAAGCCAGG - Intergenic
964210598 3:154222804-154222826 TAGTTTGCAGAAAGGGAGCCAGG + Intronic
966921128 3:184612103-184612125 TCACGAGCAGGCAGGAAGCCAGG - Intronic
966924711 3:184636763-184636785 TAGCCTGCAGTAAGGAAGCGGGG - Intronic
967557007 3:190871902-190871924 TGACCTGGAGGAAGGAAGCTGGG + Intronic
968946553 4:3667620-3667642 TAACAGGAAGGAAGGAAGGCAGG + Intergenic
969564793 4:7971365-7971387 CAGCTGGAAGGAAGGAAGCCTGG + Intronic
970219419 4:13795457-13795479 AATCTTGCAGGCAGGAAACCAGG + Intergenic
970411022 4:15808006-15808028 TCTCATGCAGGAAGGAAGGCAGG + Intronic
972302430 4:37797557-37797579 TAGCAGGCATGAAGGAAGCCAGG - Intergenic
972770906 4:42196185-42196207 CAATGTGCTGGAAGGAAGCCAGG + Intergenic
972873518 4:43329644-43329666 AAACTTGTAGGAAGGTAGACAGG + Intergenic
976615994 4:87077591-87077613 TTACTTCCAGAAAGGAAGGCTGG - Intronic
977456380 4:97266248-97266270 CATCTTGCAGGAAGGTAGGCTGG - Intronic
979467308 4:121055386-121055408 TAAGTTGGAGGAAGGAAGTGAGG + Intronic
983517507 4:168673428-168673450 TAAGTTGCAGGAAGAAGTCCAGG + Intronic
984831963 4:183984076-183984098 TGACCTGCAGGGAGGAAGCATGG - Intronic
986872539 5:12067125-12067147 TAATTTCCATAAAGGAAGCCAGG + Intergenic
988987679 5:36636797-36636819 GAGCTTGCAGGAAGGGAGCCAGG + Intronic
990886655 5:60602097-60602119 TAAGTGGCAGGAAGGGAGGCAGG + Intronic
991528302 5:67588306-67588328 TAAATTGCAGGAAGGAAAAAAGG + Intergenic
993781710 5:92074511-92074533 TTGCTTGCAGTAAGGAAGCATGG - Intergenic
995090439 5:108169447-108169469 TAACTTTAATGAAGAAAGCCAGG + Intronic
996407242 5:123117563-123117585 TAACCAGCAGGAAGGAAGATGGG + Intronic
999496925 5:152108190-152108212 TAGATTGTAGGAAGGAAGGCTGG + Intergenic
1000749780 5:165079843-165079865 TAATTTTCAGGTAGCAAGCCAGG - Intergenic
1003047491 6:2747120-2747142 TCAACTGCAGGACGGAAGCCAGG + Intronic
1004257106 6:14074621-14074643 TAAATTGCAAGAAGGAACCATGG - Intergenic
1005498212 6:26407320-26407342 TAACTTGCAGGAAGGAAGCCAGG - Intronic
1005502877 6:26445356-26445378 AATCTTGCAGGAAGGAAGCCAGG - Intronic
1006881906 6:37347525-37347547 TAACTTGCAGGATGGTAGTGAGG + Intergenic
1007050103 6:38818746-38818768 TAACTTGAAGGCAGAATGCCTGG + Intronic
1007600333 6:43077074-43077096 GAACTCGGAGGAGGGAAGCCGGG - Intronic
1008070832 6:47097271-47097293 GAACATGCAGGAAGGACGGCGGG + Intergenic
1010920140 6:81670975-81670997 CAACTTGCTGGAAGAAAGTCTGG - Intronic
1012975524 6:105777615-105777637 TAAACTCCAGGAAGGAACCCAGG + Intergenic
1013247548 6:108301186-108301208 CAACTTGCAGTAAAGAAGCCAGG - Intronic
1013430481 6:110050946-110050968 TACCTTGCTGCAAGGAAGGCTGG - Intergenic
1014219505 6:118786056-118786078 TAAATTGCATGAAGAAGGCCGGG + Intergenic
1014813465 6:125909951-125909973 TATCTAGAAGGAAGGAAGACTGG + Intronic
1016017162 6:139198416-139198438 TGACTATAAGGAAGGAAGCCTGG + Intergenic
1018196398 6:161359356-161359378 TGACTTGCGGGAGGGAAGCCCGG - Intronic
1018908462 6:168088569-168088591 TAACCTCCTGGAAGGAAGACAGG + Intergenic
1019823353 7:3262840-3262862 TATGTTGCAGTAAAGAAGCCAGG + Intergenic
1021820886 7:24496535-24496557 TAAATTGCAGGTAGGAAACAAGG + Intergenic
1022068224 7:26883243-26883265 TAACTTGAGGGAAGGAGACCAGG + Intronic
1022562104 7:31360242-31360264 AAACTTGCAGGAAGGAAAAAGGG + Intergenic
1022568582 7:31428434-31428456 TGACTTGAATGAAGGATGCCAGG - Intergenic
1022908589 7:34878688-34878710 TAACATGCAGGAAAGAGCCCAGG + Intergenic
1024817493 7:53288075-53288097 AAACTGCCAGGAAGTAAGCCTGG - Intergenic
1030006813 7:105128194-105128216 TCACTTGAAGGAAGGAAGGATGG + Intronic
1031208012 7:118787174-118787196 TAATTGGCAGGAAGGTGGCCAGG + Intergenic
1031363222 7:120871801-120871823 AAACCTGCAAGAAGCAAGCCAGG + Intergenic
1031486257 7:122329529-122329551 TAACTTGCATGAAGAAAGCACGG - Intronic
1033550413 7:142441935-142441957 TATCTTGCATAAAGCAAGCCAGG + Intergenic
1034824382 7:154248342-154248364 CACCTGGCATGAAGGAAGCCAGG + Intronic
1037052947 8:14399535-14399557 TAATTTCCAGGAAGAAAGACTGG - Intronic
1037414076 8:18630051-18630073 CAACTGACAGGAAAGAAGCCTGG + Intronic
1037742813 8:21620856-21620878 TTCTTTCCAGGAAGGAAGCCTGG - Intergenic
1038743110 8:30232928-30232950 TACCTCGCAGTAAGGGAGCCTGG - Intergenic
1038966411 8:32577937-32577959 CCACTTGCAGTAAGGAAGGCAGG + Intronic
1039602508 8:38852341-38852363 TAACTTGTATGGAGGAGGCCAGG + Exonic
1042172485 8:66005583-66005605 CACTTTACAGGAAGGAAGCCAGG - Intergenic
1042482033 8:69315048-69315070 TATCTAGCAGCAAGGGAGCCTGG - Intergenic
1044429506 8:92092132-92092154 AAACTAGAAGGAAGGAAGACTGG - Intronic
1045889043 8:107132398-107132420 GAACTTGCACGTAGAAAGCCTGG - Intergenic
1046067075 8:109210290-109210312 CAACTTGGAGGAAATAAGCCAGG + Intergenic
1046127115 8:109923527-109923549 CAACTTGCATGCTGGAAGCCTGG + Intergenic
1046712060 8:117521044-117521066 GAACATGCAGGTAGGAAGGCGGG + Exonic
1047310338 8:123686633-123686655 GAACCTCCAGGAAGGGAGCCTGG - Intronic
1047542459 8:125783507-125783529 TTACTTGTAGGCAGAAAGCCTGG + Intergenic
1047547291 8:125831089-125831111 TGAGTTGCAGGAGGGAAACCAGG - Intergenic
1047616208 8:126564478-126564500 TCAGATGAAGGAAGGAAGCCCGG + Intergenic
1047823202 8:128544053-128544075 TAACTGGGTGGAGGGAAGCCAGG + Intergenic
1048399793 8:134054100-134054122 AAGCTGGCAGGAAGGAAGCAAGG - Intergenic
1048429995 8:134361338-134361360 TAACTACCATGAAGGAAGCAGGG - Intergenic
1050204501 9:3182426-3182448 TGAATTGCAGGGAGGAAGCAAGG + Intergenic
1050746920 9:8886852-8886874 TATCTTCCAGGAATGAAGCATGG - Intronic
1051121308 9:13755500-13755522 TAACTTTCAGCAAGCAGGCCTGG + Intergenic
1051166685 9:14270010-14270032 TAACTTGCTGGATGGAGGTCAGG - Intronic
1051779628 9:20675148-20675170 TGACTTGCTGTAAGGAAGTCTGG + Intronic
1051961248 9:22765372-22765394 TAGGTTGCACAAAGGAAGCCAGG - Intergenic
1052290255 9:26832299-26832321 TAATTGGCAGGTAGGGAGCCAGG + Intergenic
1055381510 9:75712529-75712551 CAGCTAGCAGGAAGGAAGACAGG - Intergenic
1055589442 9:77796014-77796036 TAACATGGAGGAAGGAAATCTGG + Intronic
1056086364 9:83153563-83153585 TAACTTCCAGGAAGGAAAGAAGG - Intergenic
1058302274 9:103390829-103390851 AAACTTGGAGGAAGGAAGGAGGG + Intergenic
1058408144 9:104700444-104700466 TAATTTGGGGGAAAGAAGCCTGG - Intergenic
1059561237 9:115336533-115336555 TAACTAGGAGTCAGGAAGCCTGG + Intronic
1059659579 9:116387961-116387983 AAACTGGCAAGAAGGAAGTCTGG - Intronic
1060484370 9:124037767-124037789 TGTCCAGCAGGAAGGAAGCCTGG + Intergenic
1060744921 9:126124992-126125014 TAACTTTTAGTAAGGAACCCTGG + Intergenic
1061265613 9:129503198-129503220 AAACTTGGAGGCAGGAAGGCTGG + Intergenic
1061314659 9:129787459-129787481 GAGCTTGGAGGAACGAAGCCTGG + Intergenic
1061608873 9:131732911-131732933 TAACTTGCAGAAAGGAAACTGGG + Intronic
1061928140 9:133817329-133817351 TAACAGGGAGGAAAGAAGCCTGG - Intronic
1061938624 9:133872275-133872297 GAGCATGCAGGGAGGAAGCCAGG - Intronic
1186321525 X:8431755-8431777 CAACCTGCAGCAAGGAATCCAGG - Intergenic
1187195400 X:17078685-17078707 TACCTTGCAAGAAGGGAGGCTGG + Intronic
1188575315 X:31641803-31641825 CATTTTGCAGGAAAGAAGCCAGG + Intronic
1190096534 X:47485571-47485593 GAGCTTGTAGGAAAGAAGCCTGG + Intergenic
1191865971 X:65704149-65704171 AAACTTGCTGGCAGGAAGCTGGG + Intronic
1192259239 X:69494357-69494379 AGGCCTGCAGGAAGGAAGCCAGG - Intergenic
1192490636 X:71573936-71573958 TACCATGCAGGAAGCAAGTCTGG - Exonic
1192599973 X:72451874-72451896 TTACTTCCAGGTAGAAAGCCTGG - Intronic
1194417756 X:93634798-93634820 TAATTTGCAAGTAGGATGCCAGG + Intergenic
1196058054 X:111377417-111377439 TTACTTACAGAAAAGAAGCCAGG + Intronic
1196934706 X:120718182-120718204 TTATTTGCATGAAAGAAGCCAGG + Intergenic
1200037315 X:153340304-153340326 TAGCTTGCAGGGAGGAGCCCAGG + Intronic
1200056306 X:153463208-153463230 TAACTTGGAGCCAGAAAGCCTGG + Intronic
1201576902 Y:15470553-15470575 TAACTTGCAGCAAGGCTTCCTGG + Intergenic