ID: 1005500074

View in Genome Browser
Species Human (GRCh38)
Location 6:26421826-26421848
Sequence CCGGTTTCTTCAGTTGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005500074_1005500081 7 Left 1005500074 6:26421826-26421848 CCAGCGACAACTGAAGAAACCGG No data
Right 1005500081 6:26421856-26421878 CCAGAGAAGTGAGCCGAGGAGGG No data
1005500074_1005500083 17 Left 1005500074 6:26421826-26421848 CCAGCGACAACTGAAGAAACCGG No data
Right 1005500083 6:26421866-26421888 GAGCCGAGGAGGGCGGAAAAAGG No data
1005500074_1005500082 10 Left 1005500074 6:26421826-26421848 CCAGCGACAACTGAAGAAACCGG No data
Right 1005500082 6:26421859-26421881 GAGAAGTGAGCCGAGGAGGGCGG No data
1005500074_1005500079 6 Left 1005500074 6:26421826-26421848 CCAGCGACAACTGAAGAAACCGG No data
Right 1005500079 6:26421855-26421877 GCCAGAGAAGTGAGCCGAGGAGG No data
1005500074_1005500078 3 Left 1005500074 6:26421826-26421848 CCAGCGACAACTGAAGAAACCGG No data
Right 1005500078 6:26421852-26421874 CTGGCCAGAGAAGTGAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005500074 Original CRISPR CCGGTTTCTTCAGTTGTCGC TGG (reversed) Intergenic
No off target data available for this crispr