ID: 1005500777

View in Genome Browser
Species Human (GRCh38)
Location 6:26427263-26427285
Sequence ATATGCAAAGGGCCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005500770_1005500777 -5 Left 1005500770 6:26427245-26427267 CCCAGCTACAGGAAGAGCATATG 0: 2
1: 1
2: 1
3: 14
4: 276
Right 1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG No data
1005500768_1005500777 21 Left 1005500768 6:26427219-26427241 CCATCAGATGCTTAAAGACTGAG No data
Right 1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG No data
1005500771_1005500777 -6 Left 1005500771 6:26427246-26427268 CCAGCTACAGGAAGAGCATATGC 0: 2
1: 0
2: 1
3: 13
4: 107
Right 1005500777 6:26427263-26427285 ATATGCAAAGGGCCTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005500777 Original CRISPR ATATGCAAAGGGCCTGGGGA AGG Intergenic
No off target data available for this crispr