ID: 1005503410

View in Genome Browser
Species Human (GRCh38)
Location 6:26449849-26449871
Sequence CAGGGTCAGGAGTCTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005503410_1005503419 29 Left 1005503410 6:26449849-26449871 CCTCTGAGAGACTCCTGACCCTG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1005503419 6:26449901-26449923 GCCTGCACCCCCCATGGCACAGG 0: 1
1: 0
2: 2
3: 20
4: 255
1005503410_1005503418 23 Left 1005503410 6:26449849-26449871 CCTCTGAGAGACTCCTGACCCTG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1005503418 6:26449895-26449917 CATGCAGCCTGCACCCCCCATGG 0: 1
1: 0
2: 1
3: 36
4: 419
1005503410_1005503421 30 Left 1005503410 6:26449849-26449871 CCTCTGAGAGACTCCTGACCCTG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1005503421 6:26449902-26449924 CCTGCACCCCCCATGGCACAGGG 0: 1
1: 1
2: 4
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005503410 Original CRISPR CAGGGTCAGGAGTCTCTCAG AGG (reversed) Intronic
900102992 1:970781-970803 CTGGGTCAGGAGTGCCTCTGGGG - Intronic
900705955 1:4080332-4080354 CAGGGTGGGGAGTTTCTCAATGG - Intergenic
902415881 1:16238852-16238874 ATGGGCCAGGAGTCACTCAGTGG + Intergenic
903228801 1:21909596-21909618 CATGGTCAGCAGACTCTGAGGGG - Intronic
903737548 1:25539769-25539791 CAGGGCCAGGAATCTCTCTGGGG + Intergenic
904833162 1:33318572-33318594 CAGGGTCAGGAGGCTGTTATAGG - Intronic
905841537 1:41184159-41184181 CAGGGTCAGGGGAGGCTCAGAGG + Intronic
907493948 1:54829405-54829427 CTGGGGCATGATTCTCTCAGAGG + Intronic
910709381 1:90163694-90163716 CAGGGTGAGCTGTCTTTCAGGGG - Intergenic
913413991 1:118584563-118584585 CAGGGTCTGGAGTCTGTAAGGGG - Intergenic
914147338 1:145007560-145007582 CAGGGTCAGAATTTTCTCTGCGG - Intronic
915101949 1:153507199-153507221 CAGGGTGAGGACACACTCAGCGG + Intergenic
915638114 1:157200408-157200430 CAGTCTCAGGAGACTCACAGAGG - Intergenic
917209464 1:172616646-172616668 CAGGGTCAGGGGTCTTTCCATGG + Intergenic
918061851 1:181068567-181068589 CAGGGTTAGGAATGGCTCAGGGG + Intergenic
920096070 1:203487470-203487492 CAGGGTCAGGGCTCCCGCAGGGG + Exonic
921806372 1:219459987-219460009 CTGGTTCAGCAGTCTCTCCGTGG - Intergenic
922705915 1:227789891-227789913 TAGGGGCAGGAGACCCTCAGTGG + Intergenic
923146280 1:231200694-231200716 CAGGGTCATGAGTATCTCTCAGG + Intronic
923884812 1:238142708-238142730 CTGGGTTAGGAGACTCTTAGAGG + Intergenic
924584953 1:245354056-245354078 CAGGCTGAGGAGACCCTCAGAGG - Intronic
1063604350 10:7509109-7509131 CGGGGCCTGGAGTCTCTCACTGG - Intergenic
1067501049 10:46805745-46805767 GAGGGGCAGGAGGCTTTCAGAGG + Intergenic
1067593532 10:47534170-47534192 GAGGGGCAGGAGGCTTTCAGAGG - Intronic
1067640641 10:48042274-48042296 GAGGGGCAGGAGGCTTTCAGAGG - Intergenic
1073176206 10:101559190-101559212 CAGGGACAGGAGTCGCTCAAGGG - Intergenic
1073732203 10:106302553-106302575 AAGGGTTGGGAGGCTCTCAGCGG + Intergenic
1074104069 10:110375939-110375961 CAGGGTCAGGCTGCTCTCACTGG - Intergenic
1074376325 10:112943819-112943841 CAGGGCCAGGAGGGTCTCACAGG + Intergenic
1075754838 10:124802179-124802201 CAGTGTCAGGAGTCGCTCGGTGG + Intronic
1075964830 10:126602488-126602510 CAGGGTCAGGAGTTCCACAGTGG - Intronic
1076510707 10:131012022-131012044 CAGGCCCAGGAATCTCTGAGTGG - Intergenic
1076561196 10:131365720-131365742 CAGGGTCTGGCTTCCCTCAGAGG - Intergenic
1076590230 10:131577806-131577828 GAAGGGAAGGAGTCTCTCAGGGG - Intergenic
1077370550 11:2179780-2179802 CAGGGACAGGAGACACACAGGGG - Intergenic
1077403040 11:2368408-2368430 CAGGGAGAGGAGACCCTCAGTGG + Intergenic
1077458811 11:2698687-2698709 CAGGGTCTGGAGTCTGTCTTTGG - Intronic
1083570919 11:63762093-63762115 TAGGGCCCGGAGTCTCCCAGCGG + Exonic
1084628533 11:70329141-70329163 CAGGGTGCGGCCTCTCTCAGTGG - Intronic
1084692861 11:70737105-70737127 CAGTCCCAGGAGTCTCTGAGGGG - Intronic
1085395643 11:76205915-76205937 AGGGGTCAGGAGTGTCTCAGCGG + Intronic
1088837595 11:113591052-113591074 CAGGCTCAGGAGTTTCAGAGAGG - Intergenic
1090375292 11:126283802-126283824 CAGGATCAGGAATGACTCAGAGG + Intronic
1091654716 12:2337211-2337233 CATGGTCAGTAGTCCCTGAGAGG + Intronic
1092117255 12:6018425-6018447 CCAGGTCAGGAGCCTCTCGGGGG + Exonic
1094104904 12:26800966-26800988 CAGGGACAGGAGGTACTCAGAGG + Intronic
1097167089 12:57091676-57091698 CAGGGGGAGGAGTCCCTGAGGGG + Exonic
1097720138 12:63011394-63011416 CAGGGTCAGGAACCCCTCTGTGG - Intergenic
1101250377 12:102928542-102928564 AAGGGTCAGGGGTCTCTAAGTGG - Intronic
1105664457 13:22537050-22537072 CAGGGTTAGCGGTCTTTCAGAGG + Intergenic
1106688258 13:32085614-32085636 CATGCTCAGGAGTGTATCAGGGG - Intronic
1107692161 13:42964591-42964613 AAGGCTCAGGAGGCTCTCAGAGG + Intronic
1111732227 13:92090429-92090451 AAGGGGCAGGAGTCTCTCTGGGG - Intronic
1112145551 13:96696006-96696028 TAGGGAGAAGAGTCTCTCAGTGG + Intronic
1115351583 14:32401152-32401174 CAGAGCCAGGAGAATCTCAGGGG + Intronic
1121835498 14:97088610-97088632 CAGGGTCAGGGGTGTTTCATAGG + Intergenic
1122885416 14:104708351-104708373 CAGGGGCTGGAGCCTCCCAGAGG - Intronic
1124526716 15:30460818-30460840 AAGGGGCAAGAGTCTCTCCGGGG - Intergenic
1124771937 15:32546865-32546887 AAGGGGCAAGAGTCTCTCCGGGG + Intergenic
1125731985 15:41897657-41897679 CGGGGTCAGGAGACCCTCACTGG + Exonic
1127729961 15:61790721-61790743 GAGAGCCAGGAGTCTCTCAGGGG - Intergenic
1127874905 15:63103640-63103662 CAGGCTGGGCAGTCTCTCAGAGG - Intergenic
1129105185 15:73302253-73302275 CAGGTACAGGATTCTCTAAGCGG + Intronic
1129831829 15:78675763-78675785 CAGGGCCAGCAGTTTCTGAGGGG + Intronic
1129900857 15:79148468-79148490 AAGGGTAAGGGGTCTCTCTGGGG + Intergenic
1130351138 15:83092760-83092782 CATGCTCAGGAGTTTCTCTGGGG - Intergenic
1131172687 15:90189944-90189966 CAGGGTCAGCCGTCTTTCAAGGG + Intronic
1131197497 15:90367230-90367252 CAGGGTCAGGCATATCTGAGTGG - Intronic
1131357070 15:91754797-91754819 CAGGGTCAGGAGTGGCAAAGGGG - Intergenic
1132700404 16:1219845-1219867 GAGGGTCAGGAGCCACCCAGGGG + Intronic
1132998432 16:2836488-2836510 CAGCACCAGGTGTCTCTCAGTGG - Intronic
1133737257 16:8625622-8625644 CTAGGACAGGAGTCCCTCAGAGG - Exonic
1136292791 16:29285779-29285801 CAGGGTCAGGGGTCTCTCCCTGG - Intergenic
1136558711 16:31025531-31025553 CTGGCTCAGGAGGTTCTCAGTGG + Intergenic
1138661670 16:58522760-58522782 AAAGGTCAGGAGTTTCTCTGAGG - Intronic
1138984700 16:62314279-62314301 CAGGGTGTGGAGTCTCTATGAGG + Intergenic
1140190360 16:72810738-72810760 TAGGGTAGGGAGTTTCTCAGTGG - Intronic
1141777594 16:86134643-86134665 GAGGGACAGGCCTCTCTCAGTGG + Intergenic
1141851191 16:86647133-86647155 CTGGGTCAGGAGTCTTCCATGGG - Intergenic
1142057165 16:88005206-88005228 CAGGGTCAGCTGTGCCTCAGGGG + Intronic
1142098680 16:88259783-88259805 CAGGGTCAGGGGTCTCTCCCTGG - Intergenic
1143325996 17:6098824-6098846 CAGGGGCAGGTGACTCTCACTGG + Intronic
1147162955 17:38578605-38578627 CAGAGTCTGGAGGCGCTCAGCGG - Exonic
1148049959 17:44765045-44765067 CAGGGTCATCAGTCCCTCTGGGG - Intronic
1149517912 17:57294341-57294363 CAGGGGCAGGCATATCTCAGGGG + Intronic
1149895667 17:60426629-60426651 CAGGGTCAGGACCCACCCAGGGG - Intronic
1151254535 17:72865528-72865550 CAGGGTAACGAGGCTCTCAAAGG + Intronic
1151653692 17:75485697-75485719 CAGGCTCAGGAGCCACTCTGAGG - Intronic
1151673222 17:75584325-75584347 CAGGGTCAGTAGTGACTCAAAGG - Intergenic
1151715805 17:75830502-75830524 CAGGGTCAGCAGGGTCACAGCGG + Intronic
1151829887 17:76543277-76543299 CAGGCTCAGCAGTCCCTCAGAGG - Exonic
1152285910 17:79413322-79413344 CAGGATGTGGAGTCTCTGAGTGG + Intronic
1153622164 18:6989676-6989698 GAGGGTCAGGAGGCACTGAGGGG + Intronic
1154386293 18:13895455-13895477 CAGGGTCAGAAGTCTCCAGGTGG + Intronic
1159291441 18:66427368-66427390 CCGTGTCTGGAGTCTCTCATAGG + Intergenic
1159909105 18:74127008-74127030 CAGGGTCAGGAACCTCACTGTGG + Intronic
1160446966 18:78935548-78935570 CAGAGCCAGCAGTCTCCCAGGGG + Intergenic
1160590446 18:79941609-79941631 CAGGTTCAGGCTTGTCTCAGAGG - Intronic
1161283803 19:3458850-3458872 CATTGTCAAGAGGCTCTCAGGGG + Intronic
1161852349 19:6744357-6744379 CAGGGCCAGGGGGATCTCAGAGG - Intronic
1163536688 19:17880991-17881013 CAGGATAAGGAGGCTCCCAGGGG - Intronic
1164442344 19:28288917-28288939 CATGGTCAGCAGTCTCTGATCGG + Intergenic
1164753824 19:30674972-30674994 CAGCTGCAGGAGTTTCTCAGGGG - Intronic
1167107876 19:47441274-47441296 CAGGGTCGGGGGACTTTCAGGGG - Intronic
1168498755 19:56875833-56875855 CAGGGTCACGAGCATCTCAGGGG - Intergenic
925531256 2:4865120-4865142 CAGGTGCAGGAGTATCTCAGAGG + Intergenic
926009194 2:9395040-9395062 CAGGGCCAGGCCTCTCTCTGGGG - Intronic
927706459 2:25299349-25299371 CAGGCTGAGGAGTCTCTGTGAGG - Intronic
931513795 2:63029213-63029235 CAGGGTCAGCAGTGTCACTGTGG - Intronic
932497173 2:72151625-72151647 CAGAGTCAGAAGTCTATCTGAGG - Intergenic
933739240 2:85520278-85520300 CATGGTCAAGAGTTTCTCTGGGG - Intergenic
935126408 2:100227486-100227508 CAGCTTCTGGTGTCTCTCAGTGG - Intergenic
935493397 2:103747922-103747944 CAGAGTCCCGAGGCTCTCAGTGG - Intergenic
935601832 2:104929814-104929836 CAGGGTCAGCTGGCTGTCAGGGG - Intergenic
936535044 2:113305230-113305252 CAGGGAGAGGACTCTATCAGGGG - Intergenic
937764628 2:125645581-125645603 CAAGGTAAGGAGTGTCTCACAGG + Intergenic
939000016 2:136723842-136723864 CAGTTCCAGGAGTCTTTCAGTGG + Intergenic
939864431 2:147456973-147456995 CAGGCTCAGCATGCTCTCAGGGG - Intergenic
941463710 2:165800660-165800682 CAGGGACAGGAGTCCCTGACAGG + Intergenic
941921224 2:170852907-170852929 CAGCAGCAGTAGTCTCTCAGTGG - Intronic
946313254 2:218894573-218894595 CAGAGACAGGAGGCACTCAGAGG + Intronic
947745042 2:232503112-232503134 CCGGGCCAGGAGTCCCGCAGCGG - Intergenic
1169391827 20:5196973-5196995 AGGGGCCAGGAGTCTCACAGTGG + Exonic
1172008715 20:31834145-31834167 CAGGCTAAGGACTCTCCCAGTGG - Exonic
1172632241 20:36386236-36386258 CAGGGTCAGGGGTCATTCTGGGG + Intronic
1173217285 20:41096842-41096864 CAGTGGCAGGAGTCCCTCTGAGG + Intronic
1174187939 20:48720217-48720239 AAGGACCAGGAGTCACTCAGGGG - Intronic
1175565554 20:59973558-59973580 CAGACACTGGAGTCTCTCAGAGG - Intronic
1175681931 20:60995398-60995420 ATGAGTCAGGAGGCTCTCAGTGG + Intergenic
1176121618 20:63456699-63456721 GAGGCTCCGGAGACTCTCAGAGG + Intronic
1180089863 21:45528404-45528426 CAGAGTCAGGAGACACACAGGGG + Intronic
1180568688 22:16696838-16696860 CCAGGTCAGGAGCCTCTCAGGGG + Intergenic
1180911734 22:19455564-19455586 CTGGGTCAGTAGTCTCCCAAGGG - Intronic
1183213716 22:36466248-36466270 CAGGGTCTGGGGTCCTTCAGAGG + Intergenic
1183760846 22:39815636-39815658 CAGGGACAGGAGTTTCTCTAGGG - Intronic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
950138242 3:10598124-10598146 AAGGGACAGGATTCTCTGAGAGG + Intronic
951728740 3:25787263-25787285 GAGGGTGGGGAGTCTCTCACAGG - Intronic
952955219 3:38552744-38552766 TAGGGTCAGGAATCTCTGGGGGG - Intronic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
953478101 3:43223034-43223056 CATGGCCAGGAATCTCTCATGGG + Intergenic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
954177011 3:48852685-48852707 CAGGGCCAGGTGTCCCTGAGGGG - Intergenic
954429979 3:50465450-50465472 CAGGGCCAGGGGTCTTTGAGGGG + Intronic
955377465 3:58410202-58410224 CAGGATCAGGAGTCTCTAGTTGG + Intronic
959563740 3:107813214-107813236 CAGGGTAAGGAATCTCCAAGCGG - Intergenic
960753602 3:120983305-120983327 TCGGGGCAGGCGTCTCTCAGTGG + Intronic
961745300 3:129060661-129060683 CAGAGGCAGGAGGCCCTCAGGGG - Intergenic
962845844 3:139273240-139273262 CAGGGCCAGGATTATCTAAGAGG + Intronic
963712997 3:148768813-148768835 GAGGGGCAGGGGTCTCTCTGGGG - Intergenic
968454039 4:688339-688361 CAGGGGCAGGAGTCACTCTCAGG - Intronic
968952377 4:3701744-3701766 CTGGGGCAGGAGGCTCACAGAGG - Intergenic
969057274 4:4409812-4409834 CAGTGTCAGGAGTGTCCCTGTGG + Intronic
969522192 4:7684884-7684906 CAGGGTCAGGGCTCTCTGGGAGG - Intronic
972879012 4:43400386-43400408 GAGGGTCGGGAATCTCACAGAGG - Intergenic
975181745 4:71353841-71353863 CAGGGTGAGATGCCTCTCAGAGG - Intronic
979289927 4:118968241-118968263 CAGGGTCAGGAGAATGTCACTGG + Intronic
985626641 5:992269-992291 CAAGGTCAGGCATCCCTCAGTGG + Intergenic
986195442 5:5533432-5533454 CAGTGTCAGCAGACACTCAGTGG + Intergenic
988093378 5:26569809-26569831 CAGGCTCCGGGGTCTCTCTGGGG + Intergenic
992552288 5:77870230-77870252 CAGGGTCAGGGGCTTCTCAGTGG + Intergenic
992859912 5:80899379-80899401 AAGGGTCACTTGTCTCTCAGGGG - Intergenic
994610049 5:102024621-102024643 CAGGGTGAGGAGTATCACCGGGG + Intergenic
995280741 5:110332777-110332799 CAGGGGAAGGAGCATCTCAGGGG + Intronic
996218923 5:120904326-120904348 CAGGTTTAGGAGTCTTTTAGAGG + Intergenic
997606376 5:135178094-135178116 AAGTGGCAGGAGTCACTCAGTGG + Intronic
998097103 5:139402175-139402197 CAGGGGCTGGAGGTTCTCAGAGG + Intronic
998471211 5:142385334-142385356 CGGCGTTAGGAGGCTCTCAGCGG + Intergenic
999047240 5:148482490-148482512 CAGGGTCAGAGATCTGTCAGAGG - Exonic
1000281873 5:159789201-159789223 CAGGGTCAGGAGGCTATGGGAGG + Intergenic
1000324346 5:160160794-160160816 CATGGGCAGGATTCTCTGAGGGG - Intergenic
1000340650 5:160274780-160274802 CAGGGGCAGGAGGGGCTCAGAGG + Intronic
1001329296 5:170751166-170751188 CAGGCTCAGGACTCGCCCAGAGG + Intergenic
1002097569 5:176840533-176840555 CAGGGTGAGGGTTCTCTCAAAGG - Intronic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1005494173 6:26374514-26374536 CAGGATCAGGAGTTTCTCAGAGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006134226 6:31886173-31886195 AAAGGTCAGGAGGCTCTCAAAGG + Intronic
1007398636 6:41591234-41591256 CAGGGTCAGCTGCCTGTCAGGGG - Exonic
1011814569 6:91173433-91173455 CACGGTAAGGGGTCTTTCAGAGG - Intergenic
1012931721 6:105324210-105324232 CAGGGTCAAGAGCCAGTCAGGGG + Intronic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1015871387 6:137779869-137779891 CAAGGCCAGGAATTTCTCAGTGG - Intergenic
1016355072 6:143209683-143209705 CAAGGTCAGGAGTCTGACATGGG - Intronic
1019026065 6:168964004-168964026 CAGGGTTAGAGGTCTCTCAGAGG + Intergenic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023873501 7:44275047-44275069 CAGGGTCAGGGGCTTGTCAGTGG - Intronic
1024404899 7:48967575-48967597 CAGGGTCATGTGCATCTCAGTGG + Intergenic
1025724699 7:64045933-64045955 CAGGGTCTGGAGTTCCTCCGTGG + Intronic
1028380346 7:90192806-90192828 AGGGGTCACCAGTCTCTCAGAGG - Intronic
1029113245 7:98223969-98223991 CAGGGGCAGGGGTCTCCCTGGGG + Intronic
1030511704 7:110491074-110491096 CAGGTTCAAGGGGCTCTCAGTGG - Intergenic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1035260896 7:157661152-157661174 CAGGGTTCGGTGCCTCTCAGCGG + Intronic
1037581756 8:20249613-20249635 CAGGGAGTGGCGTCTCTCAGAGG + Exonic
1049538975 8:143197867-143197889 CAGGGTGAGTAGACTGTCAGGGG - Intergenic
1049565424 8:143335517-143335539 CAGGGTCAGCAGTCACGCTGGGG - Intronic
1050391608 9:5148983-5149005 CTGGGGCCAGAGTCTCTCAGAGG + Intronic
1051015861 9:12475044-12475066 CATGGGCAGGACTCTCACAGAGG + Intergenic
1052193432 9:25683924-25683946 CAGGGGCAGAACTCTCACAGGGG + Intergenic
1053051202 9:34961957-34961979 GAGGCTTAGGAGTCTCCCAGAGG + Intronic
1056455406 9:86754861-86754883 CAGGGGCAGGTGTGTTTCAGAGG - Intergenic
1059287572 9:113188370-113188392 CAGGGTAAGGAACCTCTCTGAGG - Exonic
1060204516 9:121674693-121674715 CTGGGCCAGGAAGCTCTCAGAGG - Intronic
1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG + Exonic
1061571948 9:131483309-131483331 TAGGGCCAGGAGGATCTCAGTGG + Intronic
1062444882 9:136589415-136589437 CAGGGGCCTGAGTCTATCAGAGG + Intergenic
1186890410 X:13954046-13954068 AAGGGCAAGGAGTCTCTCTGGGG + Intergenic
1187148272 X:16657351-16657373 CAGGGCCAGGCTTCTCTCTGGGG + Intronic
1189237552 X:39499283-39499305 CAGGGTCTAGAGTGGCTCAGAGG - Intergenic
1189240428 X:39520393-39520415 AAGGGGCAGCAGTCACTCAGAGG - Intergenic
1189267756 X:39729910-39729932 CAGGGTCACCAGTGTGTCAGCGG + Intergenic
1189651607 X:43195832-43195854 CTGGGTCAGGAGTCTAGGAGTGG - Intergenic
1190205038 X:48395798-48395820 CAGGGTTTGGAGTTTTTCAGAGG + Intergenic
1190205498 X:48399605-48399627 CAGGGTTTGGAGTTTTTCAGAGG - Intergenic
1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG + Intronic
1190659465 X:52641479-52641501 CAGGGTTTGGAGTTTTTCAGAGG - Intergenic
1190669410 X:52726601-52726623 CAGGGTTTGGAGTTTTTCAGAGG + Intergenic
1190670007 X:52731803-52731825 CAGGGTTTGGAGTTTTTCAGAGG - Intergenic
1190677269 X:52792914-52792936 CAGGGTTTGGAGTTTTTCAGAGG + Intergenic
1191684840 X:63879255-63879277 AAGGGTCAGGTTTCTTTCAGTGG - Intergenic
1192316130 X:70053215-70053237 CTGTCTCAGGAGTGTCTCAGTGG - Intergenic
1198792819 X:140364272-140364294 AAGGGTGAGGAGTCTCTCTCAGG - Intergenic
1200411775 Y:2868351-2868373 CAGGGTCGGGAACCTGTCAGAGG - Intronic