ID: 1005503800

View in Genome Browser
Species Human (GRCh38)
Location 6:26452375-26452397
Sequence CAGTGCGTGCCTGTAGCTTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005503800 Original CRISPR CAGTGCGTGCCTGTAGCTTA TGG (reversed) Exonic
903795142 1:25922988-25923010 CAGTGCCTGCCGTTAGCTTCAGG + Intergenic
908041770 1:60121417-60121439 CACTGCGTGCATTTAGCTTTGGG + Intergenic
1068657135 10:59587429-59587451 CAGTGCTTACCTGAAGATTAAGG - Intergenic
1070514124 10:77187838-77187860 CTCTGAGTGCCTGTAGTTTACGG + Intronic
1074705169 10:116123809-116123831 CAGTGACTGCCTGAAGCTTGGGG + Intronic
1074755009 10:116617995-116618017 CAGTGGGTGCCGGTAGCTTTTGG - Intergenic
1077588335 11:3471799-3471821 CAGGGCGTACCTGTCTCTTATGG - Intergenic
1078370680 11:10742145-10742167 CAGAGAGTACCTGTAGCTGATGG + Intergenic
1086003112 11:82003321-82003343 CTGTGCATGCCTGCAGCTGATGG + Intergenic
1089589180 11:119529583-119529605 CAGTGCTGGCCTGTAGCTCTGGG + Intergenic
1106655495 13:31741678-31741700 CTGTTAGTGCCTGTAGCTTAAGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1113830712 13:113293469-113293491 CAGTGCGTGCCCGTAGTTGGAGG + Intergenic
1117352197 14:54892260-54892282 CAGTGGGTGCCTGAAACTGAGGG - Intronic
1121422256 14:93824248-93824270 CAGGGCGTGCCTGTGGCTGCTGG - Intergenic
1121957900 14:98230839-98230861 GAGTGCCTGCCTGTAACCTATGG + Intergenic
1122271314 14:100569498-100569520 CAGTGCATGCCTGGATCCTACGG + Intronic
1125548221 15:40524584-40524606 CAGTGGTTGCCTGGGGCTTATGG + Intergenic
1125724567 15:41861725-41861747 CTGTGCCTGCCTGTAGCTCCAGG + Exonic
1127565776 15:60186849-60186871 CAGTACCAGCCTGTAGCCTAGGG - Intergenic
1146005598 17:29158734-29158756 CAGCGCGTGCCTGTGGTTTCTGG + Intronic
1151443165 17:74146804-74146826 CAGTGCTTGCCAGTGGCTCATGG - Intergenic
1157512713 18:48290222-48290244 CAGGCCATGCCTGTAGCTTCTGG + Intronic
1159049496 18:63406187-63406209 CAGTGTGTGCCAGTAGTTTCAGG + Intronic
1160931106 19:1569806-1569828 CAGTGGGTGGCTGTGGCTGAGGG - Intergenic
1163300075 19:16439557-16439579 CAGTGTGTGCCTGTGGCCTCAGG + Intronic
1163838316 19:19590002-19590024 AACAGTGTGCCTGTAGCTTAAGG - Intronic
1164658900 19:29945226-29945248 CAGTGGGTGCCTTAGGCTTAGGG + Intronic
929529500 2:42738798-42738820 CAGGGCGTACCTGTTTCTTATGG + Intronic
929762950 2:44821053-44821075 CTGTGCGTGACTGCAGCTCAAGG + Intergenic
930573182 2:53112623-53112645 CAGGGCGTACCTGTCTCTTATGG + Intergenic
931697487 2:64882277-64882299 CAGTGCATGCCTGTGGCTTTGGG + Intergenic
932793572 2:74675849-74675871 CAGTCTGTGCCTGGAGCTTCCGG + Exonic
933716883 2:85368293-85368315 TAGTGCGTGCCTGTAGTTCCAGG + Intronic
935301820 2:101698971-101698993 CAGTGCTTGCCAGTTGCTCAAGG + Intronic
937338936 2:121078597-121078619 CATTCTGTCCCTGTAGCTTAAGG - Intergenic
937998787 2:127715609-127715631 CAGTGTGTTCCTGCAGCTAATGG + Intronic
940487271 2:154311739-154311761 CAGGGCGTACCTGTCTCTTATGG - Intronic
945964026 2:216166252-216166274 TAGTGTGTGCCTGTAGCTCCAGG - Intronic
946908535 2:224438759-224438781 GAGTGGGTGGCTGTAGATTAAGG - Intergenic
948299770 2:236895178-236895200 CAGTGGGTGCCTGTAACGTCAGG + Intergenic
948424403 2:237878126-237878148 CAGTGCATGCGTGGAGCTGAAGG + Intronic
948677288 2:239604233-239604255 CAGCGCTTGCCTGTAGCCTTGGG + Intergenic
948695207 2:239729762-239729784 CAGTGCCTGCCTGAGGCTTTGGG - Intergenic
1169157310 20:3342611-3342633 CCTTGTTTGCCTGTAGCTTAAGG - Intronic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1178326750 21:31652636-31652658 CAGTGGTTGCCTGCAGCTTGGGG + Intergenic
1180099326 21:45577118-45577140 CAGTGCTTGCCTGCCTCTTATGG + Intergenic
1180159301 21:45992007-45992029 CAGGGCGAGCCTGGAGCTGACGG + Exonic
1183625423 22:38998567-38998589 CAGGGCGTACCTGTCTCTTATGG - Intergenic
953178383 3:40573431-40573453 CAGTGGCTGCCTGTAGGTAATGG - Intronic
961005022 3:123399052-123399074 CAGTGCGGGGCTGAAGCTTGGGG - Intronic
961453042 3:127011115-127011137 CTGTGCGTGCCTGTGCCTTCCGG + Intronic
961892136 3:130139180-130139202 CAGGGCGTACCTGTCTCTTATGG - Intergenic
967331512 3:188294900-188294922 CAGTGTCTGACTGTAGCTGATGG + Intronic
968322200 3:197779858-197779880 CAGTGTGTGCCTGTATCTCCAGG - Intronic
968322228 3:197779993-197780015 CAGTGTGTGCCTGTATCTCCAGG - Intronic
969745020 4:9063756-9063778 CAGGGCGTACCTGTCTCTTATGG + Intergenic
974046430 4:56902522-56902544 CAGTGCCTGGCTTTAGCTTTGGG + Intergenic
977470430 4:97436265-97436287 CAGATGGTGCCTGTACCTTAAGG - Intronic
981739758 4:147989479-147989501 CAGGGCGTACCTGTCTCTTATGG - Intronic
985766570 5:1783006-1783028 CTGTGCGTGGCTGTTTCTTAGGG - Intergenic
987116736 5:14731712-14731734 CAGTCCTTGACTGGAGCTTATGG + Intronic
995903175 5:117093668-117093690 GGGTGCGTGCTTGTTGCTTAGGG - Intergenic
1005487212 6:26312258-26312280 CCGTGCTTGCCTTTAACTTATGG - Intergenic
1005503800 6:26452375-26452397 CAGTGCGTGCCTGTAGCTTATGG - Exonic
1006720774 6:36148828-36148850 CAGGGCGTACCTGTCTCTTATGG - Intergenic
1008568804 6:52795134-52795156 TAGTGCTTGCCTGGAGCTAAAGG - Intronic
1014438120 6:121442774-121442796 CACTTAGTGCCTGTAGCTTTGGG + Intronic
1014653064 6:124065312-124065334 CAGTGCGTGCATGTCACATATGG - Intronic
1019022744 6:168932385-168932407 CAGTGCGTTCCTGTGGCTCCGGG - Intergenic
1019022755 6:168932434-168932456 CAGTGCGTTCCTGTGGCTCCAGG - Intergenic
1023663840 7:42499002-42499024 CAGTGATTGCCTGCAGCTTGGGG - Intergenic
1025062356 7:55821331-55821353 CAGTGGGTGCCTGAAGCTTCAGG + Intronic
1028412084 7:90540738-90540760 CACTGGGTGCATCTAGCTTAAGG - Intronic
1033994147 7:147324923-147324945 CACTGCATGCCTGTAGGTAATGG + Intronic
1036280669 8:7397839-7397861 CAGAGCGTTACTGTAGCTTTGGG - Intergenic
1036283715 8:7424305-7424327 CAGAGCGTTACTGTAGCTTTGGG - Intergenic
1036337756 8:7887224-7887246 CAGAGCGTTACTGTAGCTTTGGG + Intergenic
1036340797 8:7913734-7913756 CAGAGCGTTACTGTAGCTTTGGG + Intergenic
1036514454 8:9430865-9430887 CAGGGCGTACCTGTCTCTTATGG + Intergenic
1038076657 8:24083258-24083280 CAGTGTTTGCCGGTAGATTATGG - Intergenic
1041311232 8:56518942-56518964 CAGAGCCTCTCTGTAGCTTAGGG + Intergenic
1041477662 8:58283602-58283624 CAGAGCGTGCCTGGAGCTTGGGG + Intergenic
1054532971 9:66200725-66200747 CAGGGCGTACCTGTCTCTTATGG + Intergenic
1061890581 9:133617064-133617086 CAGTGGGTGCCTGAGGCTTTGGG + Intergenic
1186845851 X:13530192-13530214 CAGTGGTTGCCTGGAGCTGAAGG - Intergenic
1187132172 X:16513498-16513520 CAGTGGTTGCCTGTAGATTGTGG + Intergenic
1195823111 X:108969016-108969038 CAGGGCGTACCTGTCTCTTATGG + Intergenic