ID: 1005505049

View in Genome Browser
Species Human (GRCh38)
Location 6:26462380-26462402
Sequence GCTAACATGTTGCCCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 554}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005505049_1005505055 16 Left 1005505049 6:26462380-26462402 CCCAGCCTGGGCAACATGTTAGC 0: 1
1: 0
2: 2
3: 35
4: 554
Right 1005505055 6:26462419-26462441 TGCCTGTAATCCTAGCTAGTTGG 0: 26
1: 2873
2: 61815
3: 123301
4: 280896
1005505049_1005505059 30 Left 1005505049 6:26462380-26462402 CCCAGCCTGGGCAACATGTTAGC 0: 1
1: 0
2: 2
3: 35
4: 554
Right 1005505059 6:26462433-26462455 GCTAGTTGGGAGACTGAAGCAGG No data
1005505049_1005505056 17 Left 1005505049 6:26462380-26462402 CCCAGCCTGGGCAACATGTTAGC 0: 1
1: 0
2: 2
3: 35
4: 554
Right 1005505056 6:26462420-26462442 GCCTGTAATCCTAGCTAGTTGGG 0: 15
1: 2086
2: 47545
3: 203024
4: 531462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005505049 Original CRISPR GCTAACATGTTGCCCAGGCT GGG (reversed) Intronic
900269491 1:1779704-1779726 TTTACCATTTTGCCCAGGCTGGG + Intronic
900692299 1:3987996-3988018 GGGAACAGGTGGCCCAGGCTTGG + Intergenic
901266576 1:7915032-7915054 TTTACCATGTTGCCCAAGCTGGG + Intergenic
901287085 1:8089112-8089134 TTCACCATGTTGCCCAGGCTGGG + Intergenic
901695777 1:11006961-11006983 TTCACCATGTTGCCCAGGCTAGG + Intergenic
901851409 1:12018462-12018484 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
901948740 1:12724680-12724702 CTCACCATGTTGCCCAGGCTGGG + Intronic
902270228 1:15298970-15298992 CTTACTATGTTGCCCAGGCTGGG - Intronic
902357602 1:15916929-15916951 TTCACCATGTTGCCCAGGCTGGG - Intronic
902909848 1:19587546-19587568 TTTGTCATGTTGCCCAGGCTGGG - Intergenic
903449902 1:23445949-23445971 TCTACTCTGTTGCCCAGGCTGGG - Intronic
903470957 1:23587130-23587152 TTTACCATGTTTCCCAGGCTGGG + Intronic
903635736 1:24813912-24813934 CTTACCATGTTGCCCAGGCTGGG + Intronic
904105115 1:28073630-28073652 TTTACCATGTTGACCAGGCTGGG + Intronic
904202045 1:28826324-28826346 TCTGCCATGTTGCCCAGGCTGGG - Intronic
904219903 1:28958614-28958636 TTCACCATGTTGCCCAGGCTTGG - Intronic
904446449 1:30576809-30576831 GGAAGCATGTTGGCCAGGCTGGG - Intergenic
904482505 1:30802811-30802833 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
904765153 1:32840180-32840202 TTTACCATGTTGGCCAGGCTGGG + Intronic
905681063 1:39871160-39871182 TCTCCCTTGTTGCCCAGGCTGGG - Intronic
906109929 1:43315854-43315876 TTTGCCATGTTGCCCAGGCTAGG - Intronic
906362610 1:45176558-45176580 GCTAAAATGTAGACCAGGCCGGG - Intronic
906371375 1:45256836-45256858 TTTGCCATGTTGCCCAGGCTGGG + Intronic
906470565 1:46126662-46126684 GCTAACATGTTTGCCAGGCATGG + Intronic
907443523 1:54492691-54492713 TTCACCATGTTGCCCAGGCTGGG + Intergenic
907494434 1:54833877-54833899 ACGCACTTGTTGCCCAGGCTGGG + Intronic
908222059 1:62017215-62017237 TTCACCATGTTGCCCAGGCTGGG - Intronic
908246582 1:62232083-62232105 GTCACTATGTTGCCCAGGCTGGG + Intergenic
908254851 1:62294785-62294807 GCTGGCATGCTGCCGAGGCTGGG - Intronic
908297056 1:62723233-62723255 TGCACCATGTTGCCCAGGCTGGG - Intergenic
908360644 1:63366001-63366023 GTTCTCTTGTTGCCCAGGCTGGG - Intergenic
908513162 1:64865954-64865976 TTCACCATGTTGCCCAGGCTAGG + Intronic
910240670 1:85082639-85082661 TCTCATATGTTGCCCAGGCTGGG + Intronic
910252908 1:85216965-85216987 TTTTCCATGTTGCCCAGGCTGGG - Intergenic
910938614 1:92508130-92508152 TCACTCATGTTGCCCAGGCTGGG - Intergenic
911178029 1:94836712-94836734 TTCACCATGTTGCCCAGGCTGGG - Intronic
915204116 1:154256606-154256628 CCCATCCTGTTGCCCAGGCTGGG - Intronic
915408515 1:155681398-155681420 GTTGACATTTTGCCCAGGTTGGG - Intronic
915421525 1:155786337-155786359 TTCAACATTTTGCCCAGGCTAGG - Intronic
916024910 1:160825004-160825026 TTCACCATGTTGCCCAGGCTGGG - Intronic
916982836 1:170157016-170157038 GCTCACAGGCTGCCCAGGGTTGG - Intronic
918184773 1:182116920-182116942 CTTACCATGTTGCCCAGGCTGGG + Intergenic
918226771 1:182491082-182491104 CTTGCCATGTTGCCCAGGCTAGG + Intronic
919092595 1:192992821-192992843 CTTGCCATGTTGCCCAGGCTGGG + Intergenic
919681540 1:200440456-200440478 TTTACCATGTTGGCCAGGCTGGG - Intergenic
919906187 1:202079950-202079972 TTTACCATGTTTCCCAGGCTGGG - Intergenic
919980007 1:202637123-202637145 TTCACCATGTTGCCCAGGCTGGG - Intronic
920083098 1:203391030-203391052 CTCAACATGTTGCCCAGGATAGG + Intergenic
920967869 1:210716136-210716158 GAAAGCATGTTGCACAGGCTGGG + Intronic
921205031 1:212841358-212841380 TTCAACATGTTGCCCAGGCTGGG + Intronic
921927189 1:220721160-220721182 GCTACCATGGAGCCCATGCTTGG - Intergenic
922286475 1:224174989-224175011 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
922473219 1:225889155-225889177 GCTATAAAGCTGCCCAGGCTTGG - Intronic
922491627 1:226021658-226021680 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
922695126 1:227727454-227727476 CCCTCCATGTTGCCCAGGCTGGG - Intergenic
922753215 1:228080720-228080742 GAGATTATGTTGCCCAGGCTGGG + Intergenic
924475438 1:244378678-244378700 GCTAATCTGTGGCCCAGGCAAGG - Intronic
1062866377 10:858953-858975 TCAACCATGTTGTCCAGGCTGGG - Intronic
1063265415 10:4443610-4443632 CCCACTATGTTGCCCAGGCTGGG - Intergenic
1063634154 10:7765248-7765270 GCTACTATGTTGACCAGCCTGGG + Intronic
1064019112 10:11795097-11795119 CTCAACATGTTGCCCAGGCTGGG + Intergenic
1064117266 10:12589208-12589230 TTCACCATGTTGCCCAGGCTGGG + Intronic
1064727868 10:18299512-18299534 TTCACCATGTTGCCCAGGCTGGG - Intronic
1065170939 10:23028111-23028133 TTTCACTTGTTGCCCAGGCTGGG - Intronic
1065611644 10:27477055-27477077 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1065769226 10:29061612-29061634 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1066022054 10:31313612-31313634 CCTGCTATGTTGCCCAGGCTGGG + Intergenic
1066143293 10:32529216-32529238 TTTCACATGTTGGCCAGGCTGGG + Intronic
1067148961 10:43714122-43714144 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1067316462 10:45170176-45170198 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1067343287 10:45420969-45420991 GCCAAACTGTGGCCCAGGCTGGG - Intronic
1067608281 10:47686406-47686428 TTTACCATGTTGCCTAGGCTAGG + Intergenic
1068520030 10:58067624-58067646 TCTCCTATGTTGCCCAGGCTGGG + Intergenic
1069845515 10:71368197-71368219 GATACTCTGTTGCCCAGGCTGGG - Intergenic
1070030050 10:72668207-72668229 ACTAACTTTTTGGCCAGGCTCGG - Intergenic
1070262680 10:74872711-74872733 TCTGCTATGTTGCCCAGGCTGGG + Intronic
1070294790 10:75151548-75151570 CCCACCGTGTTGCCCAGGCTGGG + Intronic
1072132950 10:92514634-92514656 CTTACTATGTTGCCCAGGCTGGG + Intronic
1072473922 10:95740319-95740341 TTTACCATGTTGGCCAGGCTGGG + Intronic
1072817047 10:98519641-98519663 GCTAGCATGATGCCCACCCTGGG - Intronic
1072879129 10:99206402-99206424 TTCACCATGTTGCCCAGGCTAGG - Intronic
1073221527 10:101878441-101878463 CTTACTATGTTGCCCAGGCTAGG - Intronic
1074036886 10:109748280-109748302 GGTTCCTTGTTGCCCAGGCTGGG - Intergenic
1074070596 10:110064859-110064881 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1074833436 10:117265891-117265913 TTCAACATGTTGGCCAGGCTGGG - Intronic
1075058119 10:119235178-119235200 TTCACCATGTTGCCCAGGCTGGG + Intronic
1075162820 10:120039874-120039896 CTTACCATGTTGCCCAGGCTGGG - Intergenic
1075338201 10:121624049-121624071 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1076165469 10:128278787-128278809 GGTAACTAGTTGCCCAAGCTTGG + Intergenic
1076636874 10:131886979-131887001 CTCACCATGTTGCCCAGGCTGGG - Intergenic
1077032980 11:478252-478274 TTCGACATGTTGCCCAGGCTAGG - Intronic
1077854704 11:6111864-6111886 GCTAGCATGATTCCAAGGCTGGG - Intergenic
1077997492 11:7466522-7466544 GTCACCATGTTGGCCAGGCTGGG - Intronic
1078259927 11:9695990-9696012 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1080436252 11:32247676-32247698 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1080468552 11:32521956-32521978 TTCACCATGTTGCCCAGGCTAGG + Intergenic
1080492437 11:32780935-32780957 CTTGCCATGTTGCCCAGGCTGGG - Intronic
1081532114 11:43969150-43969172 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1081587531 11:44397663-44397685 TTTGTCATGTTGCCCAGGCTGGG + Intergenic
1082284273 11:50302211-50302233 TCTGCCATGTTCCCCAGGCTGGG - Intergenic
1083016763 11:59462204-59462226 CCTAACATGTGCCCCAGACTAGG + Intergenic
1083892466 11:65602907-65602929 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1083974086 11:66103119-66103141 ACTCACAGGTTGGCCAGGCTTGG - Intronic
1084329138 11:68419986-68420008 TTCACCATGTTGCCCAGGCTGGG + Intronic
1084404507 11:68963400-68963422 TTTACCATGTTGTCCAGGCTCGG + Intergenic
1085006331 11:73094012-73094034 TTTACCATGTTGGCCAGGCTGGG - Intronic
1085048368 11:73366531-73366553 CTCACCATGTTGCCCAGGCTGGG - Intronic
1085704029 11:78769994-78770016 TCTAATATGTTGCACAGGGTAGG - Intronic
1088133998 11:106531598-106531620 GTTTCTATGTTGCCCAGGCTGGG + Intergenic
1089041410 11:115453693-115453715 TTTACCATGTTGGCCAGGCTGGG + Intronic
1089412383 11:118256617-118256639 CTCAACCTGTTGCCCAGGCTAGG - Intronic
1089507004 11:118970288-118970310 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1089843822 11:121442436-121442458 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1089937794 11:122383586-122383608 TCAAACCTCTTGCCCAGGCTGGG - Intergenic
1089973923 11:122716369-122716391 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1089974282 11:122718837-122718859 TTCACCATGTTGCCCAGGCTGGG - Intronic
1090177100 11:124660257-124660279 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1090288947 11:125525070-125525092 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1090375938 11:126289473-126289495 TTTACCATGTTGGCCAGGCTAGG + Intronic
1090565115 11:127981990-127982012 TCCACCATGTTGCCCAGGCTGGG + Intergenic
1091422729 12:357303-357325 GTCACTATGTTGCCCAGGCTGGG - Intronic
1091531738 12:1363750-1363772 TCCACCATGTTGCGCAGGCTGGG + Intronic
1091755003 12:3045540-3045562 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1091904481 12:4173186-4173208 GTCAAGATGTTGCCAAGGCTGGG + Intergenic
1092685343 12:11037841-11037863 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1093120762 12:15268254-15268276 ATCACCATGTTGCCCAGGCTGGG + Intronic
1093159041 12:15723111-15723133 TTCACCATGTTGCCCAGGCTGGG - Intronic
1093260939 12:16937062-16937084 TTCAACATGTTGCCCAGGCTGGG + Intergenic
1094129038 12:27055000-27055022 CTTGCCATGTTGCCCAGGCTGGG - Intronic
1095579966 12:43786227-43786249 TTCACCATGTTGCCCAGGCTGGG + Intronic
1096129183 12:49143947-49143969 CTTGCCATGTTGCCCAGGCTGGG + Intergenic
1096222583 12:49841008-49841030 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1097064022 12:56306966-56306988 TTTGGCATGTTGCCCAGGCTTGG + Intronic
1097239644 12:57566437-57566459 TCTCTCTTGTTGCCCAGGCTGGG + Intronic
1097673816 12:62574573-62574595 TTTGCCATGTTGCCCAGGCTTGG + Intronic
1097762409 12:63482731-63482753 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1097810293 12:64011903-64011925 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1098125608 12:67289581-67289603 TTCACCATGTTGCCCAGGCTGGG + Intronic
1098411034 12:70183871-70183893 TTTGCCATGTTGCCCAGGCTAGG - Intergenic
1098913037 12:76229632-76229654 CTTACTATGTTGCCCAGGCTGGG - Intergenic
1098913632 12:76235418-76235440 TTCACCATGTTGCCCAGGCTAGG - Intergenic
1099308559 12:80989185-80989207 GATAAGCTGTTGCCAAGGCTTGG + Intronic
1099498287 12:83379202-83379224 CCTCACAAGTTCCCCAGGCTTGG - Intergenic
1100419737 12:94421253-94421275 CCCACTATGTTGCCCAGGCTTGG + Intronic
1100994385 12:100287314-100287336 CTTAATATGTTGCTCAGGCTGGG + Intronic
1101778073 12:107811737-107811759 TTCACCATGTTGCCCAGGCTTGG - Intergenic
1101906686 12:108832098-108832120 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1102016515 12:109651373-109651395 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1102126021 12:110481557-110481579 TTCACCATGTTGCCCAGGCTTGG + Intronic
1102293118 12:111717158-111717180 TTCACCATGTTGCCCAGGCTGGG - Intronic
1102300968 12:111770973-111770995 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1102359476 12:112272077-112272099 GTTAAGTTGTTGCCCAGGCTGGG + Intronic
1102442809 12:112976541-112976563 GTCACCATGTTGCCCAGGCTGGG - Intergenic
1102523381 12:113493441-113493463 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1102922036 12:116798770-116798792 TTCACCATGTTGCCCAGGCTGGG + Intronic
1103553721 12:121753372-121753394 TTGACCATGTTGCCCAGGCTGGG - Intronic
1103620667 12:122185277-122185299 CCCACTATGTTGCCCAGGCTGGG - Intronic
1103665023 12:122556950-122556972 CTTACCATGTTGCCCAGGCTGGG + Intronic
1104451870 12:128875767-128875789 TCACTCATGTTGCCCAGGCTGGG - Intronic
1105361912 13:19726692-19726714 CTTGATATGTTGCCCAGGCTGGG - Intronic
1105382209 13:19898072-19898094 ACTAACATGTTGCCTATCCTTGG - Intergenic
1106943072 13:34798532-34798554 TTCACCATGTTGCCCAGGCTTGG - Intergenic
1107295668 13:38904821-38904843 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1107736398 13:43403648-43403670 CACACCATGTTGCCCAGGCTGGG - Intronic
1107902646 13:45032838-45032860 TTCACCATGTTGCCCAGGCTGGG - Intronic
1108297772 13:49041778-49041800 GCTTTGTTGTTGCCCAGGCTGGG - Intronic
1109181011 13:59213946-59213968 TTTCACATGTTGCCCAGGCTGGG + Intergenic
1110101671 13:71613906-71613928 TTCACCATGTTGCCCAGGCTGGG + Intronic
1110214789 13:73013538-73013560 TTTGCCATGTTGCCCAGGCTAGG - Intronic
1110628254 13:77676166-77676188 GATGACATGTTGGCTAGGCTTGG - Intergenic
1111871229 13:93835256-93835278 TTTACCATGTTGCCTAGGCTGGG - Intronic
1111968558 13:94885954-94885976 GCTGACAGATTGCCCAGTCTAGG - Intergenic
1112279863 13:98053436-98053458 CTCACCATGTTGCCCAGGCTAGG + Intergenic
1112630801 13:101159428-101159450 ACTAACATGTTGCCTATGCTGGG + Intronic
1113058307 13:106293882-106293904 CAGAATATGTTGCCCAGGCTGGG + Intergenic
1113726134 13:112603692-112603714 TCACTCATGTTGCCCAGGCTGGG - Intergenic
1113874830 13:113587681-113587703 TTCACCATGTTGCCCAGGCTGGG + Intronic
1114291512 14:21292508-21292530 CTCACCATGTTGCCCAGGCTGGG - Intronic
1114323538 14:21567196-21567218 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1115514389 14:34170774-34170796 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1115529885 14:34317341-34317363 GCACTCGTGTTGCCCAGGCTGGG - Intronic
1115592607 14:34878932-34878954 CTTACCCTGTTGCCCAGGCTGGG + Intergenic
1115660594 14:35490450-35490472 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1116262717 14:42652335-42652357 CTTACCATGTTGCCTAGGCTGGG + Intergenic
1117129419 14:52670109-52670131 TTTGCCATGTTGCCCAGGCTAGG + Intronic
1117288659 14:54311344-54311366 TTTACCATGTTGGCCAGGCTTGG - Intergenic
1117344732 14:54820968-54820990 GCTGAGATCATGCCCAGGCTGGG + Intergenic
1117968069 14:61225934-61225956 TTTGTCATGTTGCCCAGGCTGGG + Intronic
1118782297 14:69016961-69016983 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1119026019 14:71153051-71153073 GCTTACAAGTTGGTCAGGCTTGG + Intergenic
1119353014 14:73981605-73981627 TTCACCATGTTGCCCAGGCTTGG - Intronic
1119374086 14:74174807-74174829 CTTGACATGTTGCCCAGGCTAGG - Intronic
1119714742 14:76851053-76851075 GCTTACATGTTCCACAGGGTTGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121518245 14:94568193-94568215 GATCAGATTTTGCCCAGGCTGGG + Exonic
1122247208 14:100412006-100412028 TCACCCATGTTGCCCAGGCTGGG - Intronic
1122489296 14:102102837-102102859 CTTACTATGTTGCCCAGGCTAGG - Intronic
1123504488 15:20926380-20926402 GCTAACATGTTGCCCATCAGAGG + Intergenic
1123561734 15:21500081-21500103 GCTAACATGTTGCCCATCAGAGG + Intergenic
1123597978 15:21937362-21937384 GCTAACATGTTGCCCATCAGAGG + Intergenic
1124495624 15:30185165-30185187 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1124590431 15:31048779-31048801 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1124747949 15:32353481-32353503 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1124833720 15:33175263-33175285 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1124952204 15:34334037-34334059 TCACACTTGTTGCCCAGGCTGGG - Intronic
1125179678 15:36868501-36868523 TTCACCATGTTGCCCAGGCTCGG + Intergenic
1125401705 15:39311270-39311292 TTTACCATGTTGGCCAGGCTGGG + Intergenic
1125580501 15:40782025-40782047 CTTGCCATGTTGCCCAGGCTTGG - Intronic
1126378417 15:48020077-48020099 CTTACTATGTTGCCCAGGCTAGG - Intergenic
1127016338 15:54692783-54692805 CTTACCCTGTTGCCCAGGCTGGG - Intergenic
1127144765 15:56012912-56012934 CTTACCCTGTTGCCCAGGCTGGG - Intergenic
1127533287 15:59865758-59865780 GATAACAAATTGCCCAGACTTGG - Intergenic
1127563167 15:60160817-60160839 TCTCACTTGATGCCCAGGCTGGG + Intergenic
1128208609 15:65874848-65874870 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1128771668 15:70287219-70287241 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1128852811 15:70977613-70977635 TCTTGCTTGTTGCCCAGGCTTGG - Intronic
1128933154 15:71723870-71723892 TTCACCATGTTGCCCAGGCTGGG - Intronic
1129084232 15:73071710-73071732 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1129603830 15:77015082-77015104 GCTAGCCTGGGGCCCAGGCTGGG - Intronic
1130309828 15:82743633-82743655 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1130926147 15:88387336-88387358 AATAACATCTTGGCCAGGCTTGG - Intergenic
1130985908 15:88844329-88844351 CTTGTCATGTTGCCCAGGCTGGG + Intronic
1131104173 15:89719274-89719296 AAAAACATGTTGCTCAGGCTGGG + Intronic
1131513269 15:93061343-93061365 GTTTCGATGTTGCCCAGGCTCGG + Intronic
1132124719 15:99212785-99212807 ACTACTATATTGCCCAGGCTGGG - Intronic
1202970079 15_KI270727v1_random:227207-227229 GCTAACATGTTGCCCATCAGAGG + Intergenic
1132520698 16:386676-386698 TTCACCATGTTGCCCAGGCTGGG - Intronic
1132902048 16:2262143-2262165 TCACACTTGTTGCCCAGGCTGGG - Intronic
1133079789 16:3309557-3309579 TTCACCATGTTGCCCAGGCTGGG - Intronic
1133209533 16:4255734-4255756 TTTGCCATGTTGCCCAGGCTAGG - Intergenic
1133795384 16:9042217-9042239 TTTACCATGTTGCCCAAGCTGGG - Intergenic
1133821027 16:9236765-9236787 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1134367814 16:13595526-13595548 TTTACCATGTTGCCCAGGCTGGG + Intergenic
1135767958 16:25194175-25194197 GCCAACATGGTGGCCAGCCTTGG + Intergenic
1135962602 16:27010217-27010239 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1137378419 16:47975213-47975235 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1139093268 16:63674971-63674993 CCCACCATGTTGCCCAGGCTGGG + Intergenic
1139819273 16:69707637-69707659 TTCACCATGTTGCCCAGGCTGGG + Intronic
1140031476 16:71342813-71342835 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1140086981 16:71805822-71805844 TTTGTCATGTTGCCCAGGCTGGG - Intronic
1140180911 16:72717791-72717813 TTTGCCATGTTGCCCAGGCTTGG - Intergenic
1140777247 16:78260740-78260762 TTCACCATGTTGCCCAGGCTAGG - Intronic
1141062010 16:80882341-80882363 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1141256455 16:82406927-82406949 GCTAACATGTTGAGCAGAATGGG + Intergenic
1141556479 16:84839791-84839813 TTTACCATGTTACCCAGGCTGGG - Intronic
1142388197 16:89780424-89780446 GTCATCATGTTGCCCAGGCCGGG - Intronic
1142472112 17:170376-170398 GTCCACATGTGGCCCAGGCTGGG + Intronic
1142874568 17:2843788-2843810 GGAAAGATGTTGCCCAGGCAAGG - Intronic
1142908511 17:3066264-3066286 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1142926053 17:3237980-3238002 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1143969186 17:10780853-10780875 TTTACCATGTTGCCCACGCTGGG + Intergenic
1144377897 17:14663880-14663902 GTTAACTTGTTCCCCAGACTTGG + Intergenic
1145068259 17:19779333-19779355 TTTACCATGTTGGCCAGGCTTGG - Intronic
1146114898 17:30126679-30126701 GCTAAAAGATTGCTCAGGCTGGG - Intronic
1146205162 17:30898056-30898078 CTTACCTTGTTGCCCAGGCTGGG - Intronic
1146601387 17:34219919-34219941 GCAAACATGTGACCCAGGATAGG - Intergenic
1146772688 17:35583333-35583355 TTTACCATGTTGGCCAGGCTGGG + Intronic
1147349290 17:39827502-39827524 CTCACCATGTTGCCCAGGCTGGG + Intronic
1147851624 17:43448034-43448056 TCTTGCATATTGCCCAGGCTGGG + Intergenic
1148435608 17:47682023-47682045 GATCTCCTGTTGCCCAGGCTGGG + Intronic
1148473280 17:47909446-47909468 TTCACCATGTTGCCCAGGCTGGG + Intronic
1148711100 17:49681557-49681579 GCCAACAGCTTGTCCAGGCTGGG + Intergenic
1148881650 17:50732590-50732612 CTTACTATGTTGCCCAGGCTAGG + Intronic
1149266715 17:54934912-54934934 TTCACCATGTTGCCCAGGCTGGG + Intronic
1149704374 17:58682143-58682165 TTCACCATGTTGCCCAGGCTGGG + Intronic
1149718341 17:58816988-58817010 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1149830051 17:59864174-59864196 GACAGCCTGTTGCCCAGGCTGGG + Intronic
1150749214 17:67844595-67844617 TTCACCATGTTGCCCAGGCTGGG + Intronic
1151480249 17:74366281-74366303 TTTACCATGTTGCCCGGGCTGGG - Intergenic
1151630911 17:75310134-75310156 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1151851751 17:76694780-76694802 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1152008555 17:77697054-77697076 GCTAGCAGCTTCCCCAGGCTGGG + Intergenic
1152176207 17:78789164-78789186 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1152220320 17:79060847-79060869 TTCATCATGTTGCCCAGGCTGGG + Intergenic
1153036862 18:771744-771766 TTTGTCATGTTGCCCAGGCTGGG + Intronic
1153216766 18:2827956-2827978 TCTATGATGTTGCCCAGGCTGGG + Intergenic
1153895924 18:9560081-9560103 TTCACCATGTTGCCCAGGCTGGG - Intronic
1154040893 18:10854901-10854923 TTCACCATGTTGCCCAGGCTGGG + Intronic
1155762797 18:29588434-29588456 GCGAACATGCTACCCAGCCTGGG + Intergenic
1155960771 18:31993024-31993046 GCAAACAGATTGCCTAGGCTTGG - Intergenic
1155975983 18:32132397-32132419 GGATATATGTTGCCCAGGCTGGG - Intronic
1157666106 18:49488267-49488289 TCTGACATGTTGCCCTGGCTGGG + Intronic
1157792063 18:50541554-50541576 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1157854505 18:51092672-51092694 TTTGCCATGTTGCCCAGGCTAGG + Intergenic
1158497211 18:57967329-57967351 TCCACCATGTTGGCCAGGCTGGG - Intergenic
1158605617 18:58893452-58893474 ACAGCCATGTTGCCCAGGCTGGG - Intronic
1159360071 18:67388621-67388643 GTCACCATGTTGACCAGGCTGGG + Intergenic
1160895003 19:1398292-1398314 TCTGCCATGTTGGCCAGGCTAGG + Exonic
1161505640 19:4641973-4641995 TTCACCATGTTGCCCAGGCTGGG - Intronic
1161636172 19:5390664-5390686 TTTCACATGTTGGCCAGGCTGGG + Intergenic
1161644195 19:5443253-5443275 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1161822040 19:6535517-6535539 GCCAGCATTGTGCCCAGGCTAGG + Exonic
1162083850 19:8236479-8236501 TTCACCATGTTGCCCAGGCTGGG - Intronic
1162116913 19:8436054-8436076 TTTGCCATGTTGCCCAGGCTAGG + Intronic
1162353064 19:10163156-10163178 TCCACCATGTTGGCCAGGCTAGG + Intronic
1162385524 19:10358482-10358504 GCTATGCTGCTGCCCAGGCTGGG + Intronic
1162807784 19:13147432-13147454 CTTGGCATGTTGCCCAGGCTGGG - Intronic
1163016180 19:14456319-14456341 TTCACCATGTTGCCCAGGCTGGG - Intronic
1163132660 19:15285346-15285368 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1163309466 19:16504628-16504650 TTTGAGATGTTGCCCAGGCTGGG + Intronic
1165016024 19:32880437-32880459 TCTCACATGTTGCCCAGGCTGGG - Intronic
1165361447 19:35339363-35339385 TTTACCATGTTGCCCAGGCTGGG - Intronic
1165525311 19:36349466-36349488 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1165702355 19:37948267-37948289 TTCATCATGTTGCCCAGGCTGGG - Intronic
1165848614 19:38835717-38835739 GACACCCTGTTGCCCAGGCTGGG + Intronic
1166169858 19:41020176-41020198 GCTAAAATGTACCACAGGCTGGG + Intergenic
1166762794 19:45235262-45235284 CTCAACATGTTGCCCAGGCTGGG - Intronic
1167257590 19:48440394-48440416 TTTTCCATGTTGCCCAGGCTGGG - Intronic
1167342821 19:48925987-48926009 GGTTTCACGTTGCCCAGGCTGGG - Intergenic
1167822213 19:51938458-51938480 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1167838981 19:52098308-52098330 CTCACCATGTTGCCCAGGCTGGG - Intergenic
1168670805 19:58239700-58239722 TTTACCATGTTGGCCAGGCTGGG - Intronic
926856356 2:17260476-17260498 GTGAACATGCTGCCCAGTCTAGG + Intergenic
927650761 2:24912264-24912286 TTCACCATGTTGCCCAGGCTGGG - Intronic
928513770 2:32026210-32026232 CTTACTATGTTGCCCAGGCTTGG - Intronic
929205829 2:39291687-39291709 TCCACCATGTTGTCCAGGCTGGG - Intronic
930205981 2:48587053-48587075 GCTAACATGTGGCCAGGACTGGG - Intronic
930634784 2:53792231-53792253 TTTAATAAGTTGCCCAGGCTGGG + Intronic
930642087 2:53863519-53863541 TTCACCATGTTGCCCAGGCTGGG - Intergenic
931244052 2:60478159-60478181 CTCACCATGTTGCCCAGGCTGGG + Intronic
931551994 2:63456813-63456835 TTTGCCATGTTGCCCAGGCTGGG - Intronic
931721137 2:65068628-65068650 TTCACCATGTTGCCCAGGCTGGG - Intronic
932268294 2:70387056-70387078 GTCACCATGTTGCCCAGGCTGGG - Intergenic
932464709 2:71910605-71910627 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
932551202 2:72771776-72771798 CTCACCATGTTGCCCAGGCTGGG - Intronic
932658386 2:73630071-73630093 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
932664992 2:73690092-73690114 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
932711182 2:74064607-74064629 TTCACCATGTTGCCCAGGCTGGG + Intronic
933389386 2:81651519-81651541 GCTACCATGCAGCCCATGCTCGG + Intergenic
933864834 2:86506805-86506827 TTCACCATGTTGCCCAGGCTGGG + Intronic
934781653 2:96973005-96973027 TTCACCATGTTGCCCAGGCTGGG - Intronic
935406822 2:102718499-102718521 GCTAACACAGCGCCCAGGCTGGG + Exonic
936415092 2:112300399-112300421 TTTGCCATGTTGCCCAGGCTGGG + Intronic
937330007 2:121020769-121020791 TTCACCATGTTGCCCAGGCTAGG + Intergenic
937782634 2:125856547-125856569 CTTGCCATGTTGCCCAGGCTGGG + Intergenic
938294355 2:130168224-130168246 TTTGCCATGTTGCCCAGGCTGGG - Intronic
938634762 2:133211424-133211446 TTTACTATGTTGCCCAGGCTGGG + Intronic
938846709 2:135217160-135217182 GCTAATAAGTGTCCCAGGCTTGG + Intronic
939958217 2:148544304-148544326 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
940356766 2:152752333-152752355 TTTGCCATGTTGCCCAGGCTTGG - Intronic
940835587 2:158517718-158517740 GTCATCATGTTGCCCAGGGTTGG - Intronic
941094291 2:161218197-161218219 GCTTAAATATTGCCCAGGGTGGG - Intronic
942169586 2:173276753-173276775 GATGAGAGGTTGCCCAGGCTGGG + Intergenic
942565363 2:177260977-177260999 TTTACCATGTTGGCCAGGCTGGG - Intronic
942788573 2:179731826-179731848 TCTAACATGTTGCCAGAGCTGGG + Intronic
942967071 2:181908172-181908194 TTCACCATGTTGCCCAGGCTGGG - Intronic
943934213 2:193894138-193894160 TTCACCATGTTGCCCAGGCTGGG + Intergenic
944510722 2:200462719-200462741 CTTACTATGTTGCCCAGGCTTGG - Intronic
944774790 2:202952119-202952141 GGTAACATGTTGGTCAGGCATGG - Intronic
946221559 2:218232041-218232063 TTCACCATGTTGCCCAGGCTGGG - Intronic
946686930 2:222280012-222280034 TTTACCATGTTGGCCAGGCTGGG - Intronic
947753918 2:232547218-232547240 GTCCCCATGTTGCCCAGGCTGGG - Intergenic
947977480 2:234379570-234379592 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
948072954 2:235142215-235142237 GCTAACATGTTCCACAGGTTTGG + Intergenic
948411618 2:237766971-237766993 TTCATCATGTTGCCCAGGCTGGG - Intronic
1169261333 20:4140577-4140599 ACCAACTTGTTACCCAGGCTAGG - Intronic
1169368542 20:5010690-5010712 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1169956598 20:11109816-11109838 TCTTGCTTGTTGCCCAGGCTGGG - Intergenic
1170105550 20:12751131-12751153 GATCCCTTGTTGCCCAGGCTTGG + Intergenic
1170621614 20:18001175-18001197 CTCACCATGTTGCCCAGGCTGGG - Intronic
1171468644 20:25351868-25351890 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1171501062 20:25593646-25593668 GCACTCCTGTTGCCCAGGCTGGG - Intergenic
1172155102 20:32818888-32818910 CTTGCCATGTTGCCCAGGCTGGG - Intergenic
1172871742 20:38140061-38140083 GCTAACATGTTGCCTGTCCTTGG - Intronic
1173524844 20:43723988-43724010 GCTTGCCTGTTGCCCAGGGTTGG + Intergenic
1173734715 20:45351552-45351574 CTTACTATGTTGCCCAGGCTGGG + Intergenic
1174054561 20:47788941-47788963 GCTCACATGTCCCCCAGCCTGGG + Intergenic
1174326631 20:49784165-49784187 TTTGACATGTTGGCCAGGCTGGG + Intergenic
1174433713 20:50490236-50490258 TTCACCATGTTGCCCAGGCTAGG + Intergenic
1174595990 20:51683985-51684007 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1175173751 20:57097340-57097362 GCTCACAAGTTCTCCAGGCTTGG - Intergenic
1176932338 21:14828700-14828722 TCCACCATGTTGGCCAGGCTGGG - Intergenic
1177071361 21:16512710-16512732 TTTACCATGTTGCCCAGGCTGGG + Intergenic
1177483182 21:21720479-21720501 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1178073083 21:28990947-28990969 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1178123648 21:29494652-29494674 TCTCTCTTGTTGCCCAGGCTGGG - Intronic
1179636166 21:42711281-42711303 GGTTTCTTGTTGCCCAGGCTGGG + Intronic
1181703929 22:24636172-24636194 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1181798654 22:25328631-25328653 TTCATCATGTTGCCCAGGCTTGG + Intergenic
1181966510 22:26659639-26659661 CTCACCATGTTGCCCAGGCTTGG - Intergenic
1182232668 22:28850417-28850439 TCTCCTATGTTGCCCAGGCTGGG + Intergenic
1182260072 22:29067774-29067796 GCTTTCTTGTTGCCCAGGCTGGG + Intergenic
1182261739 22:29077543-29077565 TTCACCATGTTGCCCAGGCTGGG + Intronic
1182373515 22:29829143-29829165 TCTAACCTGTTGCCCAGGCTGGG - Intronic
1182389113 22:29975800-29975822 CTCACCATGTTGCCCAGGCTGGG + Intronic
1182398697 22:30057223-30057245 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1183634312 22:39051922-39051944 TCTCTCCTGTTGCCCAGGCTGGG - Intronic
1183807841 22:40227257-40227279 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1183853939 22:40616900-40616922 TTCACCATGTTGCCCAGGCTGGG - Intronic
1183886798 22:40890668-40890690 TTCACCATGTTGCCCAGGCTGGG - Intronic
1184064091 22:42106084-42106106 GCTACCATGCTGCCCATGCCTGG + Intergenic
1184612097 22:45611035-45611057 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
949492348 3:4601320-4601342 TTCACCATGTTGCCCAGGCTGGG - Intronic
952694284 3:36247811-36247833 TTCACCATGTTGCCCAGGCTGGG + Intergenic
952911661 3:38194353-38194375 CTTGCCATGTTGCCCAGGCTGGG - Intronic
953893873 3:46778919-46778941 TTCACCATGTTGCCCAGGCTGGG - Intronic
954244981 3:49324193-49324215 TTTACCATGTTGACCAGGCTGGG + Intronic
954410935 3:50370609-50370631 GCCAATATGTTGCCCGGGCCTGG + Intronic
954744000 3:52776611-52776633 TTCACCATGTTGCCCAGGCTGGG + Intergenic
955143428 3:56292379-56292401 TTCACCATGTTGCCCAGGCTAGG - Intronic
955951575 3:64247973-64247995 ACTAACATCTTCCCCATGCTGGG + Intronic
955957374 3:64304523-64304545 GCTAACATGTTACACAGACCTGG + Intronic
956817090 3:72917558-72917580 TTTGCCATGTTGCCCAGGCTGGG - Intronic
957925976 3:86811984-86812006 GATAACATTTTTCACAGGCTTGG + Intergenic
959561559 3:107788570-107788592 TTCACCATGTTGCCCAGGCTGGG - Intronic
962786869 3:138776732-138776754 TTTACCATGTTGCCCATGCTGGG - Intronic
962791412 3:138814803-138814825 TTTGCCATGTTGCCCAGGCTGGG - Intronic
963780754 3:149483975-149483997 TTTGCCATGTTGCCCAGGCTGGG + Intronic
964096220 3:152934672-152934694 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
964139991 3:153386728-153386750 GCAAAAATGTTGGCCAGGCACGG - Intergenic
966606646 3:181827687-181827709 GTCACCATGTTGGCCAGGCTGGG + Intergenic
966791976 3:183680259-183680281 CGCAACCTGTTGCCCAGGCTAGG - Exonic
966929889 3:184669519-184669541 GCTGACTTGGTGTCCAGGCTTGG + Intronic
967192577 3:186997557-186997579 CTTACTATGTTGCCCAGGCTGGG - Intronic
967479670 3:189958882-189958904 TTTACCATGTTGACCAGGCTTGG + Intronic
967897861 3:194414264-194414286 TTTGCCATGTTGCCCAGGCTAGG - Intronic
968080859 3:195845940-195845962 TTTACCATGTTGCCCAGGCTGGG + Intergenic
968215882 3:196889919-196889941 GCTGACATGTGGCACAGGCAGGG - Intronic
968477091 4:816627-816649 CCCACCATGTTTCCCAGGCTAGG - Intronic
968776528 4:2544502-2544524 TTTACCATGTTGGCCAGGCTGGG - Intronic
970365725 4:15356031-15356053 CTTACCAAGTTGCCCAGGCTTGG + Intronic
971340415 4:25763649-25763671 TTTGCCATGTTGCCCAGGCTGGG - Intronic
971637499 4:29080627-29080649 TCACACTTGTTGCCCAGGCTGGG + Intergenic
971928137 4:33041457-33041479 GTCACCATGTTGCCCAGGCTGGG - Intergenic
971966291 4:33561209-33561231 CTTACTATGTTGCCCAGGCTAGG - Intergenic
973333751 4:48935355-48935377 AAAACCATGTTGCCCAGGCTGGG + Intergenic
973610761 4:52634310-52634332 TTTACCATGTTGGCCAGGCTGGG - Intronic
974415140 4:61596654-61596676 CTCACCATGTTGCCCAGGCTAGG - Intronic
974464070 4:62231057-62231079 TTTGCCATGTTGCCCAGGCTAGG + Intergenic
975781712 4:77847369-77847391 CTCATCATGTTGCCCAGGCTGGG + Intergenic
977235321 4:94501278-94501300 TTTGCCATGTTGCCCAGGCTGGG + Intronic
977369687 4:96119912-96119934 TCTCTCTTGTTGCCCAGGCTGGG - Intergenic
977510664 4:97958111-97958133 TTTACCATGTTGGCCAGGCTAGG - Intronic
978781635 4:112561942-112561964 TTTCACTTGTTGCCCAGGCTGGG + Intronic
979107599 4:116706888-116706910 GCTAATATCTTGGCCAGGCATGG - Intergenic
979474205 4:121135593-121135615 TTCACCATGTTGCCCAGGCTGGG + Intronic
979594102 4:122514138-122514160 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
980794079 4:137658508-137658530 GTCACCATGTTGGCCAGGCTGGG + Intergenic
980942053 4:139284154-139284176 CTCAACATCTTGCCCAGGCTGGG - Intronic
981313942 4:143323295-143323317 GTCACTATGTTGCCCAGGCTGGG + Intergenic
981695459 4:147554742-147554764 TTCACCATGTTGCCCAGGCTGGG - Intergenic
981817822 4:148851303-148851325 CTTAATCTGTTGCCCAGGCTGGG + Intergenic
982444015 4:155469207-155469229 TTCACCATGTTGCCCAGGCTGGG + Intergenic
982490932 4:156028762-156028784 TTCATCATGTTGCCCAGGCTGGG - Intergenic
983072847 4:163290531-163290553 TCTAAAATACTGCCCAGGCTGGG - Intergenic
983222504 4:165056121-165056143 TCCACCATGTTGGCCAGGCTGGG + Intergenic
983261415 4:165460975-165460997 TTTGTCATGTTGCCCAGGCTGGG - Intronic
983891232 4:173032487-173032509 TTTGCCATGTTGCCCAGGCTGGG - Intronic
986117934 5:4798638-4798660 GTCACCCTGTTGCCCAGGCTTGG + Intergenic
986147920 5:5097201-5097223 TTTACCATGTTGGCCAGGCTGGG - Intergenic
987129394 5:14846793-14846815 TTTACCATGTTGGCCAGGCTGGG - Intronic
988542964 5:32128889-32128911 TTCACCATGTTGCCCAGGCTGGG - Intronic
990572214 5:57090362-57090384 TTTACCATGTTGCTCAGGCTGGG - Intergenic
991195839 5:63931043-63931065 TTCACCATGTTGCCCAGGCTGGG + Intergenic
991696116 5:69274436-69274458 TTTGTCATGTTGCCCAGGCTGGG - Intronic
991773311 5:70059931-70059953 TTTGCCATGTTGCCCAGGCTGGG + Intronic
991852604 5:70935355-70935377 TTTGCCATGTTGCCCAGGCTGGG + Intronic
992149236 5:73885674-73885696 TTTGCCATGTTGCCCAGGCTAGG + Intronic
992241680 5:74776301-74776323 TTTGCCATGTTGCCCAGGCTGGG - Intronic
992586064 5:78241387-78241409 ACCACTATGTTGCCCAGGCTGGG + Intronic
997321858 5:132984191-132984213 GCTGAGATTTTGCCCAGTCTGGG - Intergenic
997974150 5:138429246-138429268 GTCACCATGTTGGCCAGGCTGGG + Intronic
998122289 5:139588469-139588491 TTTACCATGTTGGCCAGGCTGGG + Intronic
998155839 5:139786681-139786703 TTCACCATGTTGCCCAGGCTGGG + Intergenic
998621013 5:143794233-143794255 CCTAATAGGTTGTCCAGGCTTGG + Intergenic
999577959 5:153001440-153001462 GGTAACATGTTGCCATGGATTGG + Intergenic
999773268 5:154791406-154791428 TTTACCATGTTGGCCAGGCTGGG + Intronic
1002034340 5:176455237-176455259 TTCACCATGTTGCCCAGGCTGGG - Intronic
1002466367 5:179410824-179410846 GCTGACCGGTGGCCCAGGCTGGG + Intergenic
1003036216 6:2642587-2642609 GAGAACATGTGGCCCAGTCTAGG + Intergenic
1003096569 6:3147063-3147085 TTCAGCATGTTGCCCAGGCTGGG - Intronic
1003586860 6:7398276-7398298 CTTACTATGTTGCCCAGGCTAGG - Intronic
1003954418 6:11148499-11148521 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1004104484 6:12653227-12653249 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1004639963 6:17505543-17505565 TCTAATATGTAGCCAAGGCTGGG + Intronic
1005036714 6:21561955-21561977 TCACACTTGTTGCCCAGGCTGGG + Intergenic
1005505049 6:26462380-26462402 GCTAACATGTTGCCCAGGCTGGG - Intronic
1006049063 6:31326478-31326500 TCTACCCTGTTGTCCAGGCTGGG + Intronic
1006225010 6:32530046-32530068 GTTAACATTGTGCCCAGGCCAGG - Intronic
1006559366 6:34896630-34896652 CTTGCCATGTTGCCCAGGCTGGG - Intronic
1006927455 6:37665067-37665089 GCTGAGCTGTGGCCCAGGCTAGG + Intronic
1007927377 6:45661551-45661573 TTCACCATGTTGCCCAGGCTGGG + Intronic
1008098502 6:47365891-47365913 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1008184838 6:48376157-48376179 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1009551954 6:65108491-65108513 ATTGCCATGTTGCCCAGGCTGGG + Intronic
1011669260 6:89666459-89666481 TTTACCATGTTGGCCAGGCTGGG + Intronic
1012894930 6:104937318-104937340 GTGACCATTTTGCCCAGGCTGGG + Intergenic
1013533355 6:111040563-111040585 TCTGCTATGTTGCCCAGGCTGGG - Intergenic
1013555120 6:111248983-111249005 CTTGCCATGTTGCCCAGGCTGGG + Intergenic
1014447836 6:121549147-121549169 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1014463934 6:121731480-121731502 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1014517950 6:122401963-122401985 GCTCACATGTGGCCAAGGATGGG + Intronic
1014601813 6:123422258-123422280 TCTAACATGTTACCCAAGTTTGG + Intronic
1015097302 6:129431106-129431128 GGTAACATGTTGGCCAGGTGCGG + Intronic
1017467765 6:154710542-154710564 TCTCTCTTGTTGCCCAGGCTAGG - Intergenic
1017826883 6:158088264-158088286 TTCACCATGTTGCCCAGGCTGGG + Intronic
1017927280 6:158921494-158921516 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1018199817 6:161384344-161384366 TTCAGCATGTTGCCCAGGCTGGG - Intronic
1018544818 6:164923917-164923939 GTAAATATGTTGTCCAGGCTGGG + Intergenic
1019757113 7:2779160-2779182 ACAGCCATGTTGCCCAGGCTGGG - Intronic
1020653219 7:10900123-10900145 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1021312336 7:19110141-19110163 GCTAACATGTGGCTCAGGCCAGG - Intronic
1022134147 7:27431697-27431719 GTGAACATGTAGCCTAGGCTGGG + Intergenic
1022169705 7:27813548-27813570 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1022389091 7:29927922-29927944 TTTACCATGTTGGCCAGGCTGGG - Intronic
1022811666 7:33874679-33874701 ACTAACATGTGGGCCAGCCTTGG + Intergenic
1023787630 7:43723728-43723750 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1023814856 7:43941866-43941888 TTTACCATGTTGCCCAGGCTGGG - Intronic
1024260865 7:47573032-47573054 GGTCACGTGTGGCCCAGGCTTGG + Intronic
1025703923 7:63845169-63845191 TTCAACATGTTGGCCAGGCTGGG + Intergenic
1026337389 7:69406264-69406286 CTTACTATGTTGCCCAGGCTGGG - Intergenic
1026683864 7:72491536-72491558 CTTACCATGTTGCCCAGGCTGGG - Intergenic
1026817753 7:73525377-73525399 GCTGAGATGGTGCCCAGTCTGGG + Intergenic
1027390640 7:77700083-77700105 TCTAAAATGTTGGCCAGGCACGG - Intronic
1027448171 7:78298698-78298720 CTTGCCATGTTGCCCAGGCTGGG + Intronic
1028445665 7:90920521-90920543 GTTAGAATCTTGCCCAGGCTTGG + Intronic
1029025561 7:97413538-97413560 GTCAAGATGTTGGCCAGGCTGGG + Intergenic
1029407481 7:100384376-100384398 TCCATTATGTTGCCCAGGCTGGG - Intronic
1030106687 7:105993471-105993493 TTCACCATGTTGCCCAGGCTGGG - Intronic
1030829502 7:114203538-114203560 TTTGCCATGTTGCCCAGGCTTGG + Intronic
1031744762 7:125480881-125480903 TTCATCATGTTGCCCAGGCTGGG - Intergenic
1032196297 7:129790736-129790758 TTTACCATGTTGGCCAGGCTGGG + Intergenic
1032222522 7:130005410-130005432 ACAAACTTGTCGCCCAGGCTGGG - Intergenic
1032257563 7:130309328-130309350 GCTCACAACTTGCCCAGGCAGGG - Intronic
1032380841 7:131479329-131479351 CTTACTATGTTGCCCAGGCTTGG - Intronic
1032412469 7:131707026-131707048 TTTACCATGTTGCCCAGGCTGGG + Intergenic
1032499120 7:132386553-132386575 GGGAACAGGCTGCCCAGGCTTGG + Intronic
1032658034 7:133953155-133953177 GCTAAGATCTTGGCCAGGCACGG + Intronic
1033192235 7:139292052-139292074 TTCACCATGTTGCCCAGGCTAGG - Intronic
1033203749 7:139398048-139398070 GTTAGTGTGTTGCCCAGGCTAGG + Intronic
1033206570 7:139428274-139428296 CTCACCATGTTGCCCAGGCTGGG + Intergenic
1034265109 7:149776974-149776996 GAGGACTTGTTGCCCAGGCTGGG + Intergenic
1035902503 8:3472398-3472420 CCAATCATGTTGTCCAGGCTGGG - Intronic
1036708354 8:11061266-11061288 TTTGCCATGTTGCCCAGGCTGGG - Intronic
1037188193 8:16090170-16090192 GGTGCCATGTTGGCCAGGCTGGG - Intergenic
1038570107 8:28654566-28654588 CTTACTATGTTGCCCAGGCTGGG + Intronic
1038742391 8:30226885-30226907 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1038782756 8:30582218-30582240 TTTACCATGTTGCCTAGGCTGGG + Intronic
1039056000 8:33537341-33537363 CTTGCCATGTTGCCCAGGCTGGG - Intergenic
1039204150 8:35131174-35131196 TCTCTCTTGTTGCCCAGGCTGGG + Intergenic
1039336745 8:36599752-36599774 CTCAATATGTTGCCCAGGCTTGG + Intergenic
1039877347 8:41598287-41598309 GCTTACATGCTGCCAAAGCTGGG - Exonic
1039883589 8:41642620-41642642 TTCACCATGTTGCCCAGGCTAGG + Intergenic
1040025303 8:42776235-42776257 CTCAATATGTTGCCCAGGCTGGG + Intronic
1043670532 8:82879735-82879757 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1044594397 8:93943743-93943765 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1044663359 8:94612772-94612794 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1045282457 8:100760917-100760939 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1045282972 8:100765545-100765567 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1045776939 8:105815815-105815837 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1046372630 8:113328936-113328958 TTCATCATGTTGCCCAGGCTAGG + Intronic
1047427286 8:124758289-124758311 TTCAACATGTTGACCAGGCTGGG - Intergenic
1047511893 8:125521798-125521820 TTTGCCATGTTGCCCAGGCTGGG - Intergenic
1049542968 8:143216708-143216730 GCTGAGCTGTGGCCCAGGCTCGG - Intergenic
1050333731 9:4570883-4570905 GGTCTCATGTTGTCCAGGCTGGG - Intronic
1051626577 9:19104500-19104522 GCCACTAAGTTGCCCAGGCTGGG + Intergenic
1051868867 9:21714051-21714073 TTTGCCATGTTGCCCAGGCTAGG - Intergenic
1052229458 9:26131139-26131161 TCTAACATATAGCCAAGGCTGGG - Intergenic
1053121688 9:35552030-35552052 TCTCACTTTTTGCCCAGGCTGGG - Intronic
1054986966 9:71273069-71273091 TTCACCATGTTGCCCAGGCTTGG + Intronic
1055454068 9:76456774-76456796 TTCACCATGTTGCCCAGGCTGGG - Intronic
1055799266 9:80015214-80015236 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1056141576 9:83685581-83685603 CATGCCATGTTGCCCAGGCTGGG - Intronic
1056181804 9:84091108-84091130 TTCAACACGTTGCCCAGGCTGGG + Intergenic
1056206936 9:84328424-84328446 TTCACCATGTTGCCCAGGCTGGG - Intronic
1057621320 9:96638250-96638272 TTTACCATGTTGGCCAGGCTGGG + Intergenic
1057804367 9:98210020-98210042 TCCAATATATTGCCCAGGCTGGG + Intronic
1059166649 9:112082920-112082942 GTTTCTATGTTGCCCAGGCTGGG + Intronic
1059191304 9:112329383-112329405 GCCTCCCTGTTGCCCAGGCTGGG - Intronic
1059195059 9:112363346-112363368 CTCACCATGTTGCCCAGGCTGGG - Intergenic
1060498204 9:124133344-124133366 TTTACCATGTTGGCCAGGCTGGG - Intergenic
1060584165 9:124775831-124775853 TTCACCATGTTGCCCAGGCTGGG + Intergenic
1060710714 9:125861087-125861109 TTCACCATGTTGCCCAGGCTGGG - Intronic
1061708613 9:132471910-132471932 TTCACCATGTTGCCCAGGCTAGG + Intronic
1062405448 9:136394112-136394134 CTCACCATGTTGCCCAGGCTGGG + Intronic
1185498821 X:582463-582485 GCCGAGATGTTGCCCAGGCTGGG + Intergenic
1186179747 X:6961201-6961223 TTCACCATGTTGCCCAGGCTGGG - Intergenic
1187312184 X:18155877-18155899 TTCATCATGTTGCCCAGGCTGGG - Intergenic
1187381204 X:18803651-18803673 CTCACCATGTTGCCCAGGCTGGG + Intronic
1188330097 X:28859546-28859568 GCTAAGATCTTGCCCAGGCGCGG - Intronic
1188391922 X:29631475-29631497 TTTGCCATGTTGCCCAGGCTGGG + Intronic
1188866589 X:35320433-35320455 TTTGCCATGTTGCCCAGGCTGGG + Intergenic
1189358342 X:40328386-40328408 CCTGCTATGTTGCCCAGGCTGGG - Intergenic
1190833625 X:54080971-54080993 TTTGTCATGTTGCCCAGGCTGGG - Intronic
1194322523 X:92468070-92468092 GCCAACATATTGCATAGGCTTGG + Intronic
1195003672 X:100666677-100666699 GCTAAGAGGGTGCCCATGCTGGG - Intronic
1197189684 X:123632289-123632311 TCTGCCGTGTTGCCCAGGCTGGG - Intronic
1199981311 X:152922036-152922058 GCCAAGAGGTGGCCCAGGCTGGG - Intronic
1200593659 Y:5110235-5110257 TCAACCATGTTGCCCAGGCTGGG - Intronic
1200630678 Y:5581546-5581568 GCCAACATATTGCATAGGCTTGG + Intronic
1202073884 Y:21019049-21019071 TCAATCTTGTTGCCCAGGCTCGG - Intergenic
1202078584 Y:21060903-21060925 TCAATCTTGTTGCCCAGGCTCGG - Intergenic