ID: 1005505344

View in Genome Browser
Species Human (GRCh38)
Location 6:26464583-26464605
Sequence ATATGCAAAGGGCCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005505338_1005505344 -6 Left 1005505338 6:26464566-26464588 CCAGCTACAGGAAGAGCATATGC 0: 2
1: 0
2: 1
3: 13
4: 107
Right 1005505344 6:26464583-26464605 ATATGCAAAGGGCCTGGGGAAGG No data
1005505337_1005505344 -5 Left 1005505337 6:26464565-26464587 CCCAGCTACAGGAAGAGCATATG 0: 2
1: 1
2: 1
3: 14
4: 276
Right 1005505344 6:26464583-26464605 ATATGCAAAGGGCCTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005505344 Original CRISPR ATATGCAAAGGGCCTGGGGA AGG Intronic
No off target data available for this crispr