ID: 1005505474

View in Genome Browser
Species Human (GRCh38)
Location 6:26465574-26465596
Sequence GAGCTGTGTCCTTTCTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005505474_1005505481 28 Left 1005505474 6:26465574-26465596 CCACCATAGAAAGGACACAGCTC 0: 1
1: 0
2: 2
3: 17
4: 140
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421
1005505474_1005505479 7 Left 1005505474 6:26465574-26465596 CCACCATAGAAAGGACACAGCTC 0: 1
1: 0
2: 2
3: 17
4: 140
Right 1005505479 6:26465604-26465626 TACCAGCATACAGAAGAGAGAGG 0: 2
1: 0
2: 0
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005505474 Original CRISPR GAGCTGTGTCCTTTCTATGG TGG (reversed) Intronic
903710113 1:25317103-25317125 GTGCTGTGTCCTGGCAATGGTGG - Intronic
903717003 1:25375303-25375325 GTGCTGTGTCCTGGCAATGGTGG + Intronic
905132083 1:35769235-35769257 GAGCTGTGTCCTTTCTGGGCCGG - Intronic
905397137 1:37674078-37674100 GAGCCGTGTCCTTGATGTGGTGG + Intergenic
906948612 1:50316583-50316605 GGGCTGTCTCCTTTCTGAGGAGG + Intergenic
910738275 1:90486593-90486615 GAGCTGTTTCCTTACCATGTTGG + Intergenic
914810553 1:151024602-151024624 GGGCTGTGTCACTTCTGTGGAGG - Exonic
918067916 1:181113801-181113823 GAGCTGGGAACTTTCTCTGGAGG + Intergenic
919068719 1:192726805-192726827 GAGCTCTCTCCTTTCTCTGTGGG - Intergenic
919510329 1:198455040-198455062 GAACAGTGTCATTTTTATGGAGG - Intergenic
921143635 1:212330340-212330362 GAGATGGGTCCTTGCTATGCTGG - Intronic
921745852 1:218739944-218739966 TAGTTGTGTCCTTTTTTTGGTGG - Intergenic
1066240395 10:33527941-33527963 CATCTGTGTCATTTCTATGTTGG - Intergenic
1067062001 10:43082393-43082415 CAGCGGTGACCTTTCTGTGGTGG - Intronic
1073029277 10:100512124-100512146 GCACTGTGTCCTCTCTTTGGGGG - Intronic
1076820598 10:132936881-132936903 GAGCTCTGTCCCCTCCATGGGGG - Intronic
1077084591 11:742653-742675 GGGCTGTTCCCTTTGTATGGTGG + Intergenic
1078322345 11:10347856-10347878 GAGCTGTGTCTTTTCAACAGAGG - Intronic
1079263557 11:18907997-18908019 CAGCTGTTTCCTTTCATTGGAGG - Intergenic
1079342448 11:19623809-19623831 GAGCTGTGTTATTCCTTTGGAGG + Intronic
1081234322 11:40627835-40627857 GAGCTGGAGCCTTTCTATAGAGG - Intronic
1084407967 11:68989631-68989653 GAACTGTGTCCTTTATGTAGTGG + Intergenic
1088815705 11:113419366-113419388 GAGCTGTGTCCTTGGTAGGATGG + Intronic
1088901281 11:114119547-114119569 GTGCTGTGTTTTTTGTATGGGGG + Intronic
1089178685 11:116566223-116566245 GAGATGGGGCCTTTCTTTGGGGG - Intergenic
1089781427 11:120875690-120875712 GAGCTGTGTCATTGGCATGGGGG - Intronic
1090465843 11:126932357-126932379 GAGCTTTGCCCTTTCTGTGCGGG - Intronic
1092428656 12:8392589-8392611 GAGCAGAGTCCTTTCTAGAGGGG - Intergenic
1103584071 12:121937923-121937945 GGCACGTGTCCTTTCTATGGCGG + Intronic
1106061863 13:26300968-26300990 AAGCTGTATCCTTTCCATTGTGG + Intronic
1110561736 13:76917384-76917406 GAGCAGTCTCCTTTCTTTAGAGG - Intergenic
1110931391 13:81222993-81223015 TAGCTGTGTCCTTAATATGGTGG - Intergenic
1116486395 14:45453740-45453762 GTGCTGTGGCATTTTTATGGAGG + Intergenic
1117319453 14:54607165-54607187 GGGCTGTGTCATTCCCATGGAGG + Intronic
1119729942 14:76944813-76944835 TACCTGTGTCATTTTTATGGGGG - Intergenic
1120058950 14:79959350-79959372 GATCTCATTCCTTTCTATGGCGG - Intergenic
1121072678 14:91038853-91038875 GAGCTGTATACCTTCTGTGGTGG - Intronic
1122055750 14:99097181-99097203 GAGCTGTGTCTTTTCTCTCAAGG + Intergenic
1126906784 15:53376278-53376300 AAACTGTCTACTTTCTATGGTGG - Intergenic
1130213777 15:81949778-81949800 GGGCTGTGTTCCTTCTCTGGGGG + Intergenic
1130439539 15:83938804-83938826 GAGATGTTTCATTTGTATGGGGG + Intronic
1130809924 15:87365981-87366003 GAGCTCTTTTCTTTCTTTGGGGG - Intergenic
1132263035 15:100442619-100442641 AAGCCGTGTCCTGTCTATGCGGG + Intronic
1132642136 16:982749-982771 GAGCTGAGCCCTTTCTAAGGAGG - Intronic
1135934479 16:26768100-26768122 TAGCAGTCTCCTTCCTATGGGGG + Intergenic
1137427738 16:48393984-48394006 GAGCTTTGTCATTTCTCTGAGGG - Intronic
1143409488 17:6700120-6700142 GAGCTGAGTACTTTCTATCCTGG + Intronic
1144422735 17:15112810-15112832 GAGCTGCATCATTTCAATGGAGG + Intergenic
1147422230 17:40327599-40327621 GAGCTGTGTTCATTGTGTGGTGG + Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149043176 17:52214796-52214818 GAGCTATGTTCTTTGGATGGAGG - Intergenic
1151019983 17:70603725-70603747 GAGCTGTGTATTATCTATGTAGG + Intergenic
1151359705 17:73581559-73581581 GAGCTGTGACCTCTCTCTGCAGG + Intronic
1155075807 18:22353610-22353632 GAGTTGTTTCTTTTGTATGGTGG + Intergenic
1156086207 18:33406781-33406803 TACCTGTTTCCTTTCTTTGGGGG - Intronic
1156876971 18:42026195-42026217 GGGCTGTGTCTTGTCTATGGTGG - Intronic
1159516326 18:69463155-69463177 TAGCTGTGTCCTCGCCATGGTGG + Intronic
1160066884 18:75583891-75583913 AAGCTGTGTCCATCCTGTGGTGG + Intergenic
1161953561 19:7480734-7480756 AGGCTGTGTCCTTTTTCTGGGGG - Intronic
1164741827 19:30581585-30581607 TGGCTGTGTCCTTTCTTGGGAGG + Intronic
1168576531 19:57516226-57516248 GAGCTGTCCCCATTTTATGGGGG - Intronic
925526255 2:4805521-4805543 GGCCAGTTTCCTTTCTATGGAGG + Intergenic
927991207 2:27448575-27448597 GAGCAGTGTTCATTCTCTGGAGG + Intronic
928422022 2:31144762-31144784 GAGCTGAGGCATTTCTACGGTGG + Intronic
930159704 2:48142298-48142320 GAGATATGTCCCTTCTATGCTGG + Intergenic
936870816 2:117132653-117132675 AAGCTGTGTCCCTTCTGTGGAGG + Intergenic
941755660 2:169183028-169183050 GATCTGTGTACTTTCTAAAGGGG + Intronic
942954835 2:181762065-181762087 CACCTCTGTCCTTTCTCTGGTGG + Intergenic
944452151 2:199853936-199853958 TGGCTGTCTCCTATCTATGGAGG - Intergenic
945327903 2:208504402-208504424 GGGCTGTGTCCTTTCTGTTTTGG + Intronic
947240252 2:227986749-227986771 GAATTATTTCCTTTCTATGGGGG - Intronic
1170487284 20:16831345-16831367 GTGCTGTGCACTTTCTATCGCGG - Intergenic
1171457699 20:25281235-25281257 CAGCTCTGTCATTCCTATGGAGG - Intronic
1173370357 20:42429435-42429457 GAGCTGTGACCTTTCTGGAGGGG + Intronic
1173469152 20:43309272-43309294 GAGGTGTGTACTGTCTCTGGTGG - Intergenic
1177398045 21:20563063-20563085 GAGCTGAGTCCTCTCTGTGGTGG - Intergenic
1178073942 21:28998595-28998617 AAACTGTGTCCTTTCCACGGTGG + Intergenic
1179986705 21:44926205-44926227 GAGCCGTGACCTTGCTATGGGGG + Intronic
1181344320 22:22207050-22207072 GAGCTGGGTCCTTACTGCGGAGG - Intergenic
1182357693 22:29729736-29729758 GAGCTGTGGCCTGGCTGTGGAGG + Exonic
1182483568 22:30625915-30625937 GAAATGTTTCCTTTCAATGGAGG - Intronic
1182509789 22:30810658-30810680 CAGCTGTGTCCATTCTTTGCAGG + Intronic
1185033524 22:48458682-48458704 TAGCTGGGTCCTTCCTAAGGTGG - Intergenic
1203292044 22_KI270736v1_random:4148-4170 GAGATGTGTTCTTACTTTGGAGG - Intergenic
950523438 3:13509615-13509637 GAGCTGCATTCTTTCTCTGGAGG - Intergenic
953610659 3:44444863-44444885 GAGCAGTGTCCTGACTATAGGGG - Exonic
955753727 3:62207204-62207226 CAGCTGTGTATTGTCTATGGTGG - Intronic
955852915 3:63240454-63240476 GATCTGTGCTCTTGCTATGGGGG + Intronic
959784539 3:110277829-110277851 GGATTTTGTCCTTTCTATGGAGG + Intergenic
960461803 3:117944569-117944591 TATCTGTGTCTTTTATATGGTGG - Intergenic
960971078 3:123140710-123140732 GAGCTGTGTCATGTGTCTGGTGG + Intronic
961667054 3:128498993-128499015 GAGCCGTGGCCTCTCTAGGGAGG + Intergenic
963176979 3:142309042-142309064 GAGATGTGCCCTCCCTATGGAGG - Exonic
963630454 3:147724251-147724273 AAGCTCTGCCCTTTCTATGATGG - Intergenic
965262631 3:166504162-166504184 AAGCTGTGTCCCATCTGTGGGGG - Intergenic
966160618 3:176963839-176963861 TATCTGGGTCTTTTCTATGGTGG - Intergenic
979285685 4:118921633-118921655 GAGCTTTGGCTTTGCTATGGAGG - Intronic
981810644 4:148770357-148770379 TTACTGTGTCCTTTCTTTGGGGG - Intergenic
983012849 4:162569722-162569744 GAGATGTGTCCTTCCTAACGTGG - Intergenic
984122605 4:175765058-175765080 GAGATGTGTTTTTTCTATGTTGG + Intronic
986119836 5:4824008-4824030 GAGCTGGGGCCTTTCTCTGCAGG + Intergenic
993435798 5:87892139-87892161 GAGCTGTATCTATTCAATGGAGG - Intergenic
998041576 5:138953945-138953967 GAGCTTTGTGCTGTCTTTGGAGG - Intronic
1001794795 5:174492996-174493018 GAGCTGAGACCTTTTCATGGGGG - Intergenic
1002079620 5:176729577-176729599 GAGCTGCCTCCTCTCTGTGGGGG - Intergenic
1002269447 5:178060647-178060669 GTGCTGTGTCCTGTTTGTGGTGG - Intergenic
1003421448 6:5961804-5961826 AAGCTCTCTTCTTTCTATGGGGG - Intergenic
1004870204 6:19896623-19896645 GAGATGTTTCCTTTCTGTGGTGG + Intergenic
1005360182 6:25024062-25024084 GAGCAGTGCCCTTTATCTGGGGG + Intronic
1005500900 6:26428264-26428286 GAGCTGTGTTCTTTCTATAATGG - Intergenic
1005505474 6:26465574-26465596 GAGCTGTGTCCTTTCTATGGTGG - Intronic
1008492826 6:52103732-52103754 GAGCTGTGTCCTTCATCTTGGGG + Intergenic
1008949425 6:57139272-57139294 GAAGTTTGTCTTTTCTATGGAGG + Intronic
1011319998 6:86080594-86080616 GAGCTGTGTGAGGTCTATGGTGG - Intergenic
1011541894 6:88439750-88439772 GAGCTGTGTGCTCAATATGGTGG - Intergenic
1012476185 6:99616824-99616846 CAGCTCTTTCCTTTCCATGGAGG + Intergenic
1013414480 6:109912714-109912736 GAGCTGTGTCCTTTTTGTGATGG - Intergenic
1014601793 6:123421946-123421968 GAGATGTGACCTTTCTCTGTAGG - Intronic
1015665611 6:135625127-135625149 CAGCTGTTTCCTTTCTACTGGGG + Intergenic
1016664275 6:146616887-146616909 GAGCTTTGTCCTTTTCATTGAGG + Intronic
1018334090 6:162765499-162765521 GACCTGTGTCCATTCCATGTGGG + Intronic
1018914727 6:168126016-168126038 GAGCTGCGTCCTTCCTAGAGGGG - Intergenic
1021442193 7:20689270-20689292 CAGCTGTGCCCTTTCCATTGAGG - Intronic
1021616438 7:22507165-22507187 GAGCTGTGTCCTGGCAATGGTGG - Intronic
1021866269 7:24961564-24961586 TAGCTGTGTCCTCTAAATGGTGG - Intronic
1021965014 7:25908946-25908968 GAGCTGTGTACTTTTTTTGGGGG - Intergenic
1022926238 7:35058376-35058398 GAGCTGTGTCCTGGCAATGGTGG - Intergenic
1023079854 7:36516350-36516372 TATCTGTGTGCTTTCTGTGGGGG - Intronic
1023079859 7:36516382-36516404 TATCTGTGTGCTTTCTGTGGGGG - Intronic
1023350665 7:39317336-39317358 GAGCTGTGTCCTTTCTAAAGTGG + Intronic
1024424209 7:49207082-49207104 GAGCTGTTTCCATTCTGTGGAGG + Intergenic
1026376797 7:69759785-69759807 GAAATGAGTCCTTTATATGGGGG - Intronic
1028376017 7:90147172-90147194 GAGCTGTGTCCTGGCAATGGTGG + Intergenic
1029824248 7:103173064-103173086 GAGCTGTGTCCTGGCAATGGTGG - Intergenic
1034471480 7:151256914-151256936 GAGCAGTGTCCTTGGTGTGGAGG - Intronic
1036830647 8:12017150-12017172 GAGCAGTGTCCTTTCTGCAGGGG - Intergenic
1037106458 8:15113891-15113913 GAGCAGTGTGCTTTCTATGATGG - Intronic
1037631860 8:20665039-20665061 GAGCTCTGAACTTTCTATTGTGG - Intergenic
1044379302 8:91515270-91515292 GAGTAGTGTCCTTTCTTTGTAGG - Intergenic
1044396900 8:91723307-91723329 GAGCTGTGTCAAATCTGTGGTGG + Intergenic
1047295894 8:123570319-123570341 GAGCAGTGTCCTTTTTATTTGGG - Intergenic
1047333816 8:123917560-123917582 GAGCTATGTTTTTTCTTTGGCGG - Intronic
1048073492 8:131043287-131043309 TAGCTGTGTCCTCTCTCTGCGGG + Intergenic
1048135488 8:131743050-131743072 AAGCTGTGTCCTATCTGTGTAGG + Intergenic
1049637898 8:143699048-143699070 GGGCTGTGTCCTTTCCACAGAGG + Intronic
1050564502 9:6868174-6868196 GAGCTGAGTTCTTTCTCTCGGGG - Intronic
1052798537 9:32946403-32946425 GAGCGGTGACCTTTATCTGGGGG - Intergenic
1053538941 9:38953650-38953672 GTCCTGTGTGCTTCCTATGGTGG + Intergenic
1054627199 9:67410269-67410291 GTCCTGTGTGCTTCCTATGGTGG - Intergenic
1056657823 9:88523479-88523501 GGAATGTGTCCTTTCTAGGGAGG + Intergenic
1059365379 9:113782763-113782785 GTGCTGTGTACTTCCTGTGGAGG + Intergenic
1060821539 9:126664238-126664260 GCTCTGTGTCGTTTCCATGGTGG + Intronic
1061732668 9:132628362-132628384 GAGTTGTCTCCTTTCTAATGCGG + Intronic
1186275225 X:7930926-7930948 GAGCACTGCCCTTTCCATGGGGG + Intergenic
1187137067 X:16558296-16558318 GTGCTGTGGCCTTTCTTAGGGGG - Intergenic
1190117622 X:47636641-47636663 AAGCTGTGTGTTTTCTGTGGAGG + Exonic
1191929479 X:66354004-66354026 TATCTGTGTCCTTTCTATGGGGG - Intergenic
1195310231 X:103625141-103625163 GTGGTGTGGCCTTTCTCTGGGGG - Intronic
1195311829 X:103639100-103639122 GGGGTGTGGCCTTTCTCTGGGGG - Intergenic
1201245756 Y:12002491-12002513 GAGCTGTGTCCCTTTTGAGGAGG + Intergenic