ID: 1005505481

View in Genome Browser
Species Human (GRCh38)
Location 6:26465625-26465647
Sequence GGAAATGCACAGCAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005505480_1005505481 -4 Left 1005505480 6:26465606-26465628 CCAGCATACAGAAGAGAGAGGAA 0: 2
1: 0
2: 4
3: 30
4: 404
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421
1005505477_1005505481 4 Left 1005505477 6:26465598-26465620 CCCAGGTACCAGCATACAGAAGA 0: 2
1: 0
2: 1
3: 8
4: 129
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421
1005505475_1005505481 25 Left 1005505475 6:26465577-26465599 CCATAGAAAGGACACAGCTCTCC 0: 1
1: 0
2: 1
3: 15
4: 172
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421
1005505478_1005505481 3 Left 1005505478 6:26465599-26465621 CCAGGTACCAGCATACAGAAGAG 0: 2
1: 0
2: 2
3: 12
4: 131
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421
1005505474_1005505481 28 Left 1005505474 6:26465574-26465596 CCACCATAGAAAGGACACAGCTC 0: 1
1: 0
2: 2
3: 17
4: 140
Right 1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG 0: 1
1: 0
2: 6
3: 39
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005505481 Original CRISPR GGAAATGCACAGCAGCAGCA AGG Intronic
900827377 1:4937652-4937674 GGAAATGAACAGCAGAGGGAAGG + Intergenic
902230535 1:15024619-15024641 GGGAAGGCACAGCAGCAGCCAGG + Intronic
902342625 1:15794046-15794068 GGAATTGCAGGGTAGCAGCATGG - Intergenic
902923386 1:19680421-19680443 GGAAAGGCAGGGCAGCAGCTTGG - Intergenic
902978601 1:20107480-20107502 GGAACTGCAGAGCAGAAGGAAGG - Intergenic
903587722 1:24428917-24428939 GGAAGTGCAGAGCTGCAGAAGGG - Intronic
905031008 1:34884717-34884739 GGAGATACACAGCAGTTGCAGGG - Intronic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
905826301 1:41028281-41028303 GTCACTGCGCAGCAGCAGCAGGG + Exonic
906796500 1:48700379-48700401 TGAAATGCACAGCATTTGCATGG + Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
907773997 1:57494862-57494884 GGAATTTCACAGCTGAAGCAAGG - Intronic
908776470 1:67645819-67645841 AGAAATGCAGCGCACCAGCATGG + Intergenic
908909632 1:69058312-69058334 AGAAATCCACAGCAGCAGCAAGG - Intergenic
910358990 1:86395970-86395992 GTAAACGCCCAGCAGCAGCTAGG + Intronic
910544515 1:88398681-88398703 GGAAATGAAAAGCTCCAGCATGG + Intergenic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911779805 1:101861917-101861939 GAGATTGCACAGCAGAAGCATGG + Intronic
912009441 1:104940751-104940773 GAAACTGCAAGGCAGCAGCAAGG - Intergenic
912109997 1:106329812-106329834 GGAACTGCAAGGCAGCAGCAAGG + Intergenic
912561515 1:110555000-110555022 GGAACTGTGCAGGAGCAGCAGGG + Intergenic
912699294 1:111864631-111864653 GCAAAAGTGCAGCAGCAGCAAGG - Intronic
914453586 1:147815051-147815073 GGAGATGCCCAGGAGAAGCATGG - Intergenic
914913515 1:151804573-151804595 GGAAACTCACAGGAGCAGGAAGG - Intronic
915619260 1:157069773-157069795 GAAAAAGCACAACAGCTGCAGGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917711821 1:177692933-177692955 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
918213353 1:182371263-182371285 GGAAATGCAAAGCTGCTGCAAGG - Intergenic
918736615 1:188071924-188071946 AGGAGTCCACAGCAGCAGCAGGG + Intergenic
919557866 1:199083310-199083332 GGAACTGCACAGCCACAGCATGG - Intergenic
920340390 1:205271958-205271980 GGACACGAACACCAGCAGCACGG - Exonic
920613351 1:207464420-207464442 GGACTTTGACAGCAGCAGCAGGG + Intronic
920736485 1:208537556-208537578 GACAATCCTCAGCAGCAGCAGGG + Intergenic
921672674 1:217943851-217943873 GGTAATGCAGAGGAGCAGGAAGG - Intergenic
921981452 1:221263208-221263230 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
924129329 1:240889397-240889419 GGAATGGGACACCAGCAGCAGGG + Intronic
924259219 1:242212433-242212455 GGAAAGGCTCAGCAGCAGGGAGG + Intronic
924731345 1:246714375-246714397 CGAACTGCAAAGCAGCAGCGAGG + Intergenic
1062966773 10:1613467-1613489 GAAAATCCACCCCAGCAGCAGGG + Intronic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1063730951 10:8696629-8696651 GCAAATGAACACCAGAAGCAGGG - Intergenic
1063732879 10:8719773-8719795 GGGCATCCACAGCAGCAGTAAGG + Intergenic
1063791839 10:9458858-9458880 GGAAAGCCACAGGAGCAACAGGG - Intergenic
1066709357 10:38216678-38216700 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1067978209 10:51050470-51050492 GGAAATGCATTGCAACAACATGG - Intronic
1068153247 10:53162024-53162046 GGAACTGCAAAGCAGAAGTAGGG + Intergenic
1068409139 10:56632446-56632468 GGACATCCAAAGCAGAAGCAGGG - Intergenic
1068498596 10:57816502-57816524 GGAAGTGCACAGCACCAAGAAGG - Intergenic
1068722517 10:60261867-60261889 TGAAATCCACAGCAGCCGCTCGG + Exonic
1069233821 10:66045630-66045652 GGAAATACATAGTAGCAACAGGG - Intronic
1069509472 10:69030921-69030943 GGAAATCCACATCTGCAGGATGG + Intergenic
1069901714 10:71710395-71710417 GGAAAAGCCCAGGAGCAGGAGGG - Intronic
1070527806 10:77310280-77310302 GGATAGGCACTGCAGCAGCAGGG - Intronic
1071163533 10:82779092-82779114 TGTGATGCACAGTAGCAGCACGG + Intronic
1071973870 10:90935593-90935615 GAAAATGCATCACAGCAGCAAGG - Intergenic
1072264766 10:93716636-93716658 TGAAAGGCAAAGCAGGAGCAAGG + Intergenic
1072384326 10:94908903-94908925 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1072391217 10:94989043-94989065 GGGACTGCACAGCAGCAGCCAGG - Exonic
1073022236 10:100454863-100454885 GGAACTGCAAGGCGGCAGCAAGG + Intergenic
1073366462 10:102946281-102946303 GGAAAGGCACAGAGGCAGAAAGG + Intronic
1073739565 10:106391349-106391371 GGAAATTCACTTCATCAGCATGG + Intergenic
1074026638 10:109642580-109642602 AGAAAGCCCCAGCAGCAGCAGGG + Intergenic
1074546911 10:114408374-114408396 GGAACTGCAGAGCATGAGCAGGG + Intergenic
1075127726 10:119713907-119713929 GGCACTGCCCAGAAGCAGCAAGG - Intergenic
1075139353 10:119817980-119818002 GGAAATGCGCAGTCCCAGCAGGG + Intronic
1075370766 10:121932957-121932979 GGAGGTGAACAGGAGCAGCAGGG + Intergenic
1075736526 10:124667822-124667844 GGAGAGGCTCAGCACCAGCATGG - Intronic
1076358727 10:129871375-129871397 AGACATCCACAGCAGCAGCAGGG + Intronic
1076980707 11:203177-203199 GGTCTGGCACAGCAGCAGCAGGG + Exonic
1078558323 11:12349459-12349481 GGAAATGATGAGCAGCAGCTAGG + Intronic
1078812088 11:14778088-14778110 GGAACTGCAAAGCAGCAGCGAGG + Intronic
1079630022 11:22663053-22663075 GGAAAGGCAAAGGGGCAGCACGG + Intronic
1080031467 11:27665690-27665712 CGAACTGCAAAGCAGCAGCGAGG + Intronic
1081377502 11:42377228-42377250 AGAACTGCAAGGCAGCAGCAAGG + Intergenic
1081815752 11:45939927-45939949 GGAAATCCACAGCAGCACATTGG - Intronic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1085298089 11:75442289-75442311 GGAAAGGCTATGCAGCAGCAGGG + Intronic
1086161077 11:83722795-83722817 AGAAATGCAAAGAAGCATCAGGG + Intronic
1086249836 11:84799326-84799348 GGAAGAGCACAGCAGCTGGAGGG - Intronic
1086661628 11:89426645-89426667 CGAAATGCAAGGCAGCAGCAAGG + Intronic
1087167197 11:95016859-95016881 GAAAATGCACAGCAGTGGCCAGG + Intergenic
1088697415 11:112380356-112380378 GGAAATGCTCAGGAACAGGAGGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1090966331 11:131600578-131600600 GTAAATGCAAAGCAATAGCATGG - Intronic
1091045018 11:132317746-132317768 GGTAATGCACAGCAGGGGAAGGG - Intronic
1092134859 12:6139826-6139848 GCAAAGGCACATCAGCTGCAAGG + Intergenic
1092210556 12:6643623-6643645 CGAATAGCACAGCACCAGCAAGG + Exonic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1092942271 12:13420922-13420944 GGAACAGCACAGAAGCGGCATGG - Intergenic
1093308423 12:17547525-17547547 GGGTCTCCACAGCAGCAGCAAGG + Intergenic
1093626953 12:21360809-21360831 GGAACTGCAAGGCAGCAGCAAGG + Intronic
1094688214 12:32741701-32741723 GGAAATGTACAGCAAAAACATGG - Intronic
1095173186 12:39058915-39058937 GGAAAGCCACTGCAGAAGCAAGG + Intergenic
1096877685 12:54643444-54643466 GGAAATGCCTAGCAGTAGGATGG - Intergenic
1097107198 12:56632856-56632878 GGAGAAGCACAGCTGCAGCATGG - Intronic
1097760733 12:63460693-63460715 GGGAAGGCTCAGCAGCAGAATGG + Intergenic
1098638505 12:72813287-72813309 GGAACTGTAAGGCAGCAGCAAGG - Intergenic
1098877104 12:75877310-75877332 AGAAATTCCCAGCAACAGCAAGG + Intergenic
1099965527 12:89441037-89441059 CGAACTGCAAGGCAGCAGCAAGG + Intronic
1100148122 12:91702134-91702156 GGAGATGCACAGAAGCAAGAAGG - Intergenic
1101262516 12:103047438-103047460 TGAAATGCTGAGCAGCTGCAGGG + Intergenic
1101521384 12:105485489-105485511 GGAAACGCACTGCAACAGGACGG - Intergenic
1102028423 12:109726617-109726639 GGAGATGGTCAGGAGCAGCAGGG + Intronic
1102638835 12:114348317-114348339 GGCACTGCACTCCAGCAGCATGG + Intergenic
1102652687 12:114453579-114453601 GGAAATGCATGGAAGCAGAAAGG + Intergenic
1103004064 12:117407774-117407796 GGCAGTGCACAGCGGGAGCATGG - Intronic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1105787034 13:23759775-23759797 GAAAACCCACAGGAGCAGCAGGG + Intronic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1106738009 13:32607906-32607928 GGAAAAGCACAGTAGCAGGGTGG + Intronic
1106785075 13:33099404-33099426 GGAGATGCCCAGCAGCATCTGGG - Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107313662 13:39107329-39107351 GGAAATGAAATGCAGCATCAGGG - Intergenic
1107457233 13:40566137-40566159 GCATGTGCAGAGCAGCAGCAGGG + Intronic
1107515989 13:41130467-41130489 TGAAATGCACAGGATCAACAGGG - Exonic
1107521932 13:41192213-41192235 CGAAATGCACAGGATCAGCAGGG - Exonic
1107562313 13:41568492-41568514 GGAAAGACACAGCAAAAGCAGGG + Intronic
1108810615 13:54219359-54219381 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1110371354 13:74744101-74744123 GGAAATGCTAAGCATCAGCCTGG - Intergenic
1112197906 13:97243388-97243410 GGCCAGGTACAGCAGCAGCAAGG + Intronic
1112896223 13:104303719-104303741 GGAAATACACAGTAGAAGAAAGG + Intergenic
1113090002 13:106607740-106607762 GGAAATGCACATCATAACCACGG + Intergenic
1114074463 14:19149072-19149094 GGGAAGGCACAACACCAGCAGGG - Intergenic
1114083429 14:19220233-19220255 GGCACTGCACAGCAGCATCCTGG + Intergenic
1114087805 14:19250903-19250925 GGGAAGGCACAACACCAGCAGGG + Intergenic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1114579509 14:23744643-23744665 TGAACTGCAAGGCAGCAGCAAGG - Intergenic
1115066089 14:29261988-29262010 AGAAATTCACAGCATCAGAAAGG - Intergenic
1115362300 14:32517617-32517639 CGAACTGCAAGGCAGCAGCAAGG + Intronic
1115501362 14:34052815-34052837 GCAAATGCCCTGCAGCAGGATGG - Intronic
1116729761 14:48607118-48607140 GGAACTGCAAGGCAGCAGCGAGG + Intergenic
1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG + Intergenic
1118666341 14:68074882-68074904 GGAAATGCAGAGGAGCCACATGG - Intronic
1122370393 14:101226158-101226180 GAAAGGGCACAGCAGCAGCAGGG + Intergenic
1122400457 14:101464476-101464498 GGCAGTGCAGAGCCGCAGCAGGG + Intergenic
1122578080 14:102754522-102754544 GGAGGTGCAGAGCAGCAGCCGGG + Intergenic
1202895041 14_GL000194v1_random:2002-2024 GGCACTGCACAGCAGCATCCTGG + Intergenic
1124047249 15:26161678-26161700 GGATATGGACAGCTGCAGGAAGG + Intergenic
1125394230 15:39229508-39229530 AGAAAAGAACAGCAGCAACAGGG + Intergenic
1125919746 15:43518362-43518384 GGAAATGCAGGGCAGCCGCTGGG - Intronic
1127654027 15:61038927-61038949 GGCAGTGAAGAGCAGCAGCAAGG - Intronic
1128595172 15:68939174-68939196 GGAACTGGAGAGCAGCATCATGG + Intronic
1129479551 15:75812118-75812140 GGAAGGGCACAACAGCACCACGG - Intergenic
1129530628 15:76261497-76261519 GGTAAAGCTCAGCTGCAGCATGG - Intronic
1130233374 15:82113426-82113448 GGAAATGCAGAGCAGCTGCCAGG + Intergenic
1130384926 15:83402775-83402797 GGATAGAAACAGCAGCAGCAAGG - Intergenic
1131064652 15:89426460-89426482 GGAAATGCAAACCTTCAGCATGG - Intergenic
1131747665 15:95466781-95466803 GGAAAATCAAAGCATCAGCATGG - Intergenic
1131955206 15:97728228-97728250 GGAAATGGACGGCAGCTTCAAGG - Intergenic
1132030513 15:98435254-98435276 GGCAATGCAAATCAGCACCACGG + Intergenic
1132362907 15:101232963-101232985 GGTCAGGGACAGCAGCAGCAAGG - Intronic
1132927402 16:2438185-2438207 GGAACTGAAAAGCAGCAGAAGGG + Intronic
1133769663 16:8860381-8860403 TCAAAAGCACAGCAGCAGCTAGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135415080 16:22262973-22262995 GGCAAGGGACAGCAGGAGCAGGG + Intronic
1136283503 16:29228278-29228300 GGCACTGCACTGCAGCAGCCGGG + Intergenic
1137317949 16:47347467-47347489 CGAACTGCAAGGCAGCAGCAGGG + Intronic
1138007314 16:53350108-53350130 GGAACTGCAAGGCAGCAGCAAGG - Intergenic
1138515397 16:57533193-57533215 GAAAGGGCACAGCAGGAGCACGG + Intronic
1138859622 16:60740956-60740978 TGAAATGCAAAGCAGTACCATGG + Intergenic
1139060303 16:63242426-63242448 GGAAATGCACAGGATAACCAAGG + Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1140187245 16:72786270-72786292 GGAAATGAACTGAAGCAGTATGG - Exonic
1141313524 16:82938521-82938543 GGCACTGCCCAGCATCAGCAGGG + Intronic
1142087928 16:88194228-88194250 GGCACTGCACTGCAGCAGCCGGG + Intergenic
1143682937 17:8491153-8491175 GGGGGTGCACAGCAGCACCAAGG - Intronic
1143819548 17:9548767-9548789 GGAAAAAAACAGCAGCAGCAAGG + Intronic
1144539171 17:16122573-16122595 GGAAAGCCAGAGTAGCAGCAGGG - Intronic
1144671160 17:17133381-17133403 GGCACTGCAGAGGAGCAGCAGGG + Intronic
1144932922 17:18874708-18874730 GAAAGAGGACAGCAGCAGCAGGG - Intronic
1145101982 17:20085123-20085145 GCAAATGACCAGCAGCTGCAGGG - Intronic
1146631637 17:34474262-34474284 GGGAAAGCTCAGCAGGAGCAAGG + Intergenic
1147137175 17:38441143-38441165 GCAAATACACAGCAGCAGGCAGG - Intronic
1147240036 17:39084800-39084822 GGCCAGGCACAGGAGCAGCAGGG + Intronic
1147875280 17:43616615-43616637 GGAGATGCTCAGCAGCTCCAAGG + Intergenic
1149007062 17:51817157-51817179 GGAAATGCACAACAGATGAAGGG + Intronic
1150011682 17:61510450-61510472 GGAAAGGCAGAGCAGCAGCAGGG - Intergenic
1152419752 17:80186070-80186092 GGAAATGTCCACCAGGAGCAGGG - Intronic
1152760794 17:82106083-82106105 GGGCAGGCTCAGCAGCAGCAGGG - Intronic
1153152907 18:2114921-2114943 GCACATGCACAGCAGCAGCATGG + Intergenic
1153593512 18:6700211-6700233 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
1154034330 18:10784867-10784889 TAAAATGCACACCAGCAGAAAGG + Exonic
1154500113 18:14991896-14991918 GGAACTGCACAGCAGCATCCTGG + Intergenic
1155350555 18:24901545-24901567 CAAACTGCAAAGCAGCAGCAAGG + Intergenic
1155412669 18:25563584-25563606 GGAAAGGGACAGCAGCAGGAGGG + Intergenic
1157076719 18:44474953-44474975 GGAGAGGCACAGCACCAACAGGG - Intergenic
1157574066 18:48732107-48732129 GTGAATGCACTGCTGCAGCATGG - Intronic
1158618870 18:59013060-59013082 AGAAATCCACAGTAGCAGCCAGG + Intergenic
1158708571 18:59817008-59817030 GGAAGAGCACAACAGCAGGAAGG + Intergenic
1158820525 18:61153473-61153495 GAGAATTCACAGCATCAGCATGG + Intergenic
1161055061 19:2186781-2186803 TGAAATCCACAGCAGCAGGTCGG - Intronic
1161261730 19:3341569-3341591 GGAGAAGCCCAGCAGCAACAGGG - Intergenic
1161997493 19:7722588-7722610 ACAAATGTACAGCAACAGCACGG - Intergenic
1162248833 19:9425650-9425672 AGCAATGCACAGCAGCAGAGAGG - Intronic
1163460714 19:17435919-17435941 AGACTTGCACATCAGCAGCATGG + Exonic
1164542745 19:29132997-29133019 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
1167211600 19:48137151-48137173 CAAAATGCAGGGCAGCAGCACGG - Intronic
1167261633 19:48462218-48462240 GGCAATGCACTGCAGCACCACGG - Exonic
1168549463 19:57280857-57280879 GAAATAGCACAGCAGCAGCAAGG - Intronic
1168693648 19:58392924-58392946 GAAAATGGTCAGGAGCAGCATGG - Intronic
924971499 2:132098-132120 AGAAGTGCAAAGCGGCAGCAGGG + Intergenic
925478760 2:4247500-4247522 GGAAAGGCTATGCAGCAGCAGGG - Intergenic
925865544 2:8223224-8223246 GGACATGCACAGCAGGGGCCTGG + Intergenic
926386263 2:12338487-12338509 GGAAATGATCAGCAAGAGCAGGG - Intergenic
927264325 2:21127772-21127794 GGAAATGCAAAGGAACAGAACGG - Intronic
928072858 2:28234955-28234977 GCAACTGCACAGAATCAGCAAGG - Intronic
928789092 2:34929704-34929726 GGAAATGCATGGAAGCAGAAAGG - Intergenic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
929843897 2:45501712-45501734 CGAACTGCAAAGCGGCAGCAAGG + Intronic
929881347 2:45839907-45839929 GGAAATGCAGTTCACCAGCACGG + Intronic
930496449 2:52150939-52150961 GCAAACACATAGCAGCAGCAAGG + Intergenic
931491685 2:62754706-62754728 TGAACTGCAAGGCAGCAGCAAGG - Intronic
931519552 2:63080658-63080680 TTAAATGGACAGCATCAGCAAGG - Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
931904496 2:66827895-66827917 TGAAATGTGCAGCAGTAGCAGGG + Intergenic
931918785 2:66989444-66989466 GAAAATGTATAGCAGCAGGATGG - Intergenic
931997444 2:67852695-67852717 GGGTAAGCACATCAGCAGCAGGG + Intergenic
932086216 2:68764712-68764734 AGAGAGGAACAGCAGCAGCATGG - Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
933631320 2:84662525-84662547 CGAACTGCAAGGCAGCAGCAAGG + Intronic
933643372 2:84788001-84788023 GGAAATGGAGAACAGCAGAAGGG + Intronic
937074906 2:119096130-119096152 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
937587435 2:123569931-123569953 GGAAATCCAAAACACCAGCAAGG + Intergenic
938105015 2:128524183-128524205 GGAAATGTACACCAACAGGAAGG - Intergenic
938488798 2:131745567-131745589 GGGAAGGCACACCACCAGCAGGG - Intronic
938493152 2:131776398-131776420 GGCACTGCACAGCAGCATCCTGG - Intergenic
938499328 2:131822255-131822277 GGCACTGCACAGCAGCATCCTGG + Intergenic
939346712 2:140975387-140975409 TGAAATTTACAGCAGCAGAAAGG + Intronic
940205676 2:151198948-151198970 GGAGATGCAATGCAGCAGCATGG + Intergenic
941546861 2:166861716-166861738 GAAATTGGAAAGCAGCAGCAGGG - Intergenic
942103322 2:172607719-172607741 GAACAGGCTCAGCAGCAGCAAGG + Intronic
942361202 2:175173504-175173526 AGAAGTGCAGAGCAGCAGTAGGG - Intergenic
942516722 2:176761687-176761709 GGAAATGTATAGCTGCAGGAGGG + Intergenic
943661314 2:190562325-190562347 AGATATGTACAGCAGCACCACGG + Intergenic
944856068 2:203768313-203768335 GGAAATGAATAGCATCAGTATGG - Intergenic
948166079 2:235863694-235863716 GCCAATGCAAGGCAGCAGCATGG + Intronic
948909516 2:240996118-240996140 TGTAATGCCCAGCAGCAGCGGGG + Intergenic
1169650843 20:7865493-7865515 GGAAATGCCCAGCCTCAGCTGGG - Intergenic
1171306800 20:24113549-24113571 GGAGCTGGACAGCAGCAGCAGGG + Intergenic
1172531284 20:35632885-35632907 GGAAATGGACAGCTGAACCAAGG + Exonic
1172532998 20:35646672-35646694 GGAAATGAACAGCAGCAGAATGG + Intronic
1174591650 20:51649975-51649997 GCAATTGCACTGCAGAAGCAGGG + Intronic
1174662594 20:52227127-52227149 TGAAATGCACAGCAGCTGGATGG - Intergenic
1175532332 20:59682556-59682578 GGAAATGAACAGGAGAAGTAGGG + Intronic
1175790336 20:61736690-61736712 GGATATGCACAGCTGAAGAAGGG - Intronic
1175791354 20:61741892-61741914 GCAATTGGACAGCAGCAGGAGGG - Intronic
1176241921 20:64079364-64079386 GGGCGTGCACTGCAGCAGCAGGG + Exonic
1176614743 21:9017989-9018011 GGCACTGCACAGCAGCATCCTGG + Intergenic
1176710466 21:10145882-10145904 GGCACTGCACAGCAGCATCCTGG - Intergenic
1179522748 21:41955689-41955711 GGAATGGCACAGCAGCTGGACGG + Intergenic
1180290109 22:10842012-10842034 GGGAAGGCACAACACCAGCAGGG - Intergenic
1180294546 22:10873034-10873056 GGCACTGCACAGCAGCATCCTGG - Intergenic
1180492907 22:15871434-15871456 GGGAAGGCACAACACCAGCAGGG - Intergenic
1180497352 22:15902448-15902470 GGCACTGCACAGCAGCATCCTGG - Intergenic
1182110742 22:27721432-27721454 GGAAATGCACAGGAGATGCCAGG + Intergenic
1184968882 22:48001196-48001218 CGACATGCACCACAGCAGCAGGG - Intergenic
1185333181 22:50260721-50260743 GGAGATGGACAGCAGCAGAGTGG + Intronic
949283480 3:2373870-2373892 GGAAATTCATTGCAACAGCACGG + Intronic
949379077 3:3424431-3424453 GGAAATGAAGAGCAACAGGAAGG + Intergenic
950067694 3:10126303-10126325 GCAACTTCCCAGCAGCAGCACGG - Exonic
950315122 3:11995322-11995344 GGTAAGGCACAGCTGCAGAAAGG - Intergenic
950604496 3:14065566-14065588 GCAAATGCCCACCAGCGGCAGGG - Exonic
950706568 3:14786043-14786065 GGAAATGGACAACACTAGCAGGG - Intergenic
951446848 3:22792211-22792233 AGAAATGGACAACAGGAGCATGG - Intergenic
951758493 3:26118353-26118375 GGAAATGCAAAGGAGCTGCGTGG + Intergenic
952073727 3:29670673-29670695 CGAACTGCAAGGCAGCAGCAAGG + Intronic
952206279 3:31184062-31184084 GCAAATGCTCAGCAAAAGCAGGG - Intergenic
952237448 3:31494587-31494609 GGGAATGCAGAGAAGCACCACGG - Intergenic
953515967 3:43592020-43592042 CGAACTGCAAGGCAGCAGCAAGG + Intronic
954973975 3:54675635-54675657 AGGAATGCACAGCAGCATGATGG - Intronic
955804700 3:62722119-62722141 GCAAAATCACAGAAGCAGCAAGG + Intronic
955926110 3:64006686-64006708 GGCAGTGGACAGAAGCAGCATGG + Intergenic
956922235 3:73942103-73942125 GGAATTGCACAGCAGGAGTTTGG - Intergenic
957130200 3:76214585-76214607 CGAACTGCAAGGCAGCAGCAAGG + Intronic
957591597 3:82206096-82206118 TAAACTTCACAGCAGCAGCAGGG - Intergenic
957990971 3:87627344-87627366 TAAAATCCACAGCAGCAGAAAGG + Intergenic
958045601 3:88280374-88280396 GAAAATGCAAAAGAGCAGCAAGG + Intergenic
959056093 3:101569067-101569089 GGAAATGGACAGGCGGAGCACGG + Intergenic
959725630 3:109538594-109538616 GGAACTGCAAGGCAGCAGCAAGG + Intergenic
959953711 3:112211629-112211651 CGAACTGCAAGGCAGCAGCAAGG + Intronic
960792806 3:121452005-121452027 CGAACTGCAAGGCAGCAGCAAGG - Intronic
960888164 3:122417864-122417886 GGAAGAGAAAAGCAGCAGCAGGG - Intergenic
961051480 3:123750772-123750794 GGGAAAGCACAGCACCAGGATGG + Intronic
961754529 3:129120309-129120331 GGCAGAGCCCAGCAGCAGCAAGG + Intronic
961780963 3:129319828-129319850 GGAAATGAACTGCATCATCAGGG - Intergenic
962115402 3:132500862-132500884 GGAAATGCCTAGCATCATCAAGG + Exonic
962249530 3:133827270-133827292 TGACATGCCCAGCAGCAGCCTGG + Exonic
963281734 3:143390873-143390895 TGAACTGCAAGGCAGCAGCAAGG + Intronic
963445757 3:145405577-145405599 GAGAAAGCATAGCAGCAGCATGG - Intergenic
965020411 3:163221745-163221767 GCCATTGCACAGCAGCAGCCTGG - Intergenic
965311061 3:167129633-167129655 GGAAAAGCACAGTATTAGCATGG - Intergenic
966437473 3:179904847-179904869 GGGACAGCACAGCAGCAGTAGGG - Intronic
966494130 3:180560316-180560338 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
967665531 3:192167497-192167519 GGAAAAGCACAGTACCAGCTAGG + Intronic
968376036 4:42273-42295 TGAACTGCAAGGCAGCAGCAAGG - Intergenic
969353307 4:6610768-6610790 CCATAGGCACAGCAGCAGCATGG - Intronic
969366257 4:6696146-6696168 AGATCTGAACAGCAGCAGCAGGG - Intronic
970977969 4:22062968-22062990 GGCAATGCACAAAAGGAGCATGG + Intergenic
971244802 4:24917867-24917889 GGAAACGCAGAGAGGCAGCAGGG + Intronic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
971876754 4:32318356-32318378 GGAACTGCACAGCCCCAGAAAGG + Intergenic
973779445 4:54274466-54274488 AGACATGCACAGGGGCAGCAAGG - Intronic
974261933 4:59536499-59536521 TGATATGCATAGCAGCAGCGTGG + Intergenic
975094521 4:70442530-70442552 ACATATGCACAGTAGCAGCATGG + Intronic
975383830 4:73732218-73732240 GGTAATGCACACCATCACCATGG + Intergenic
975632840 4:76419970-76419992 GTAAATGCACAACAACAGTAAGG + Intronic
977477983 4:97537467-97537489 CGAACTGCAAGGCAGCAGCAAGG + Intronic
978063324 4:104365018-104365040 GGAAATACAAAGGAGCTGCATGG + Intergenic
978959344 4:114657196-114657218 GGAACTGAACACAAGCAGCAGGG - Intronic
984602661 4:181746150-181746172 GGAACTGAACAGCAGGAGGAGGG + Intergenic
986099155 5:4590001-4590023 GGACATGCACAGCAGAAGTCTGG - Intergenic
988314286 5:29603419-29603441 TGAATTGCAAGGCAGCAGCAAGG + Intergenic
988403484 5:30793555-30793577 AGAACTGCACAGCAGAAACATGG + Intergenic
988470224 5:31530978-31531000 GGAAATGTACAGTAGCAACATGG - Intronic
988859395 5:35261675-35261697 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
988955621 5:36314595-36314617 GGAAATAAAGAGCAGCAGAAAGG - Intergenic
990439506 5:55830646-55830668 AGGATGGCACAGCAGCAGCAAGG - Intergenic
990761649 5:59136888-59136910 TTAAAAGGACAGCAGCAGCAAGG + Intronic
990882517 5:60555880-60555902 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
992197093 5:74350805-74350827 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
993019533 5:82575047-82575069 GCAAACGCATGGCAGCAGCAAGG - Intergenic
994809857 5:104501980-104502002 GGAAGAGAACAGCAGCAGAAGGG - Intergenic
997413376 5:133707154-133707176 GGAATGGGAGAGCAGCAGCAGGG - Intergenic
997840421 5:137234393-137234415 GGAAAGGCGATGCAGCAGCAGGG - Intronic
998390533 5:141784394-141784416 GGAAGTGGACAGCAGCAGCAGGG + Intergenic
1000331190 5:160206834-160206856 GGACATGCACGGCAGCACCTGGG + Intronic
1000728882 5:164805936-164805958 AGCAGTGTACAGCAGCAGCAAGG + Intergenic
1001233170 5:170007417-170007439 GGAAAAGCACAACAGCAATAAGG + Intronic
1002174544 5:177394094-177394116 GCAGGTGCACAGCAGCACCAGGG - Exonic
1002463944 5:179394616-179394638 GGTAGTGTACAGCAGCAGCAGGG - Intergenic
1003397079 6:5762836-5762858 TCACAGGCACAGCAGCAGCAGGG + Intronic
1004029025 6:11847837-11847859 GAAAATTTACAGCAGCATCAAGG - Intergenic
1004641985 6:17524504-17524526 AGCAATGTGCAGCAGCAGCAGGG + Intronic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1007262921 6:40576458-40576480 GGCATTGCAGCGCAGCAGCATGG + Intronic
1007787710 6:44290744-44290766 GGCAATGCACACCAGCAACCTGG - Intronic
1007977864 6:46119856-46119878 GGAACTGCAAGGCAGCAGCGAGG + Intergenic
1010179300 6:73066308-73066330 GGAAATGCAGAGCAGGATGAGGG - Intronic
1010234674 6:73565390-73565412 TCACAGGCACAGCAGCAGCATGG - Intergenic
1011027197 6:82882015-82882037 GTAAGTGGAGAGCAGCAGCAGGG - Intergenic
1011139121 6:84133583-84133605 TGAACTGCAAGGCAGCAGCAAGG - Intronic
1011953332 6:92995581-92995603 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
1012450862 6:99351022-99351044 GGAAGGGCACAGAAGGAGCATGG - Intergenic
1012607736 6:101178880-101178902 GGAACAGCAGAGAAGCAGCATGG - Intergenic
1013906146 6:115222363-115222385 GGAAAAGCACAGTATTAGCATGG - Intergenic
1014128481 6:117804670-117804692 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
1014881224 6:126726670-126726692 GGAACTGCAAGGCAGCAGCGAGG + Intergenic
1015096790 6:129424839-129424861 GTAAATACACAGAAGCAGAATGG - Intronic
1016681366 6:146833160-146833182 GGAAAAGCACAGCAGCACGGAGG + Intergenic
1017632063 6:156405943-156405965 GGAAATACACAAGAGCAGCCTGG + Intergenic
1017976092 6:159358710-159358732 GGAACTGCGGAGCAGCGGCATGG - Intergenic
1018387898 6:163321693-163321715 GGAAATGCCCAGCAGGCGCTGGG - Intergenic
1018935613 6:168272062-168272084 AGACACGCACAGCAGCAACACGG + Intergenic
1018943609 6:168329085-168329107 GGGAAAGCACAGGAGCAGGAGGG - Intergenic
1019507641 7:1400687-1400709 AGCCATGCACAGCAGCAGCCCGG - Intergenic
1019638772 7:2091184-2091206 GGAAATACACAGGAGGAGCCTGG - Intronic
1019639897 7:2097710-2097732 AGAGACACACAGCAGCAGCAGGG + Intronic
1019904822 7:4053799-4053821 ATCAATTCACAGCAGCAGCAGGG - Intronic
1020343542 7:7138538-7138560 GGAATAGCACAGAAGGAGCAGGG + Intergenic
1020777490 7:12473160-12473182 GGATATGCAAAGTAACAGCATGG - Intergenic
1021630947 7:22646857-22646879 GGCAGGGCACAGCAGCAGCATGG + Intergenic
1022027385 7:26461286-26461308 GCAAATGTTCAGCAGCAACAAGG - Intergenic
1022453586 7:30537889-30537911 CGAACTGCAAGGCAGCAGCAAGG + Intronic
1022472187 7:30688787-30688809 GGACTTGCAAAGCAGCAGCCCGG - Intronic
1022742061 7:33131593-33131615 GAAAATGAACAACAGCTGCAAGG + Intronic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023402812 7:39802748-39802770 GGAATTGCAGGGTAGCAGCATGG - Intergenic
1024646818 7:51377889-51377911 GGAATTGCAGGGTAGCAGCATGG + Intergenic
1027363276 7:77431233-77431255 GGAAATGAAAGGCTGCAGCAGGG + Intergenic
1027603840 7:80274690-80274712 GAAGATGAAAAGCAGCAGCAAGG - Intergenic
1029270195 7:99373045-99373067 GAAAATACGCAGGAGCAGCAAGG + Intronic
1029310563 7:99659793-99659815 CGAACTGCAAGGCAGCAGCAAGG - Intronic
1029576808 7:101408775-101408797 AGATCTGCACAGCCGCAGCAAGG - Intronic
1031999628 7:128256300-128256322 GCAAAAACACAGCAGCAGGATGG - Exonic
1032203079 7:129837157-129837179 GGAAATGTCCAGCAGCAGCTTGG + Intronic
1033767072 7:144505699-144505721 GGAACAGAACAGCAGCAGAAAGG + Intronic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034439308 7:151078561-151078583 GGAAACGCAACTCAGCAGCAAGG - Exonic
1035680342 8:1483141-1483163 GCAAACGCCCAGCAGCAGCTCGG - Intergenic
1037004418 8:13759592-13759614 GGCAAAGCACAGTAGCAGCAGGG - Intergenic
1037672855 8:21029996-21030018 CGATATCCACAGCAGCAGCATGG - Intergenic
1037687502 8:21155576-21155598 AGGAATGAATAGCAGCAGCATGG + Intergenic
1038112167 8:24511754-24511776 GAAAAGGGACAGCAGCAGCCTGG - Intronic
1039121110 8:34147319-34147341 GGACGTGCTCAGCAGCAGAATGG + Intergenic
1039475841 8:37839029-37839051 GAAGAGGCAGAGCAGCAGCAAGG - Exonic
1039857795 8:41431424-41431446 GGAGGCGCACAGCAGCAGCGTGG - Intergenic
1039881386 8:41627401-41627423 GGAAGTCCGCAGCAGCAGCCTGG - Intergenic
1040276873 8:46018327-46018349 GGAACTGCAAAGCAGCAAGAAGG - Intergenic
1040909854 8:52506883-52506905 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
1041027377 8:53700874-53700896 GGAACTGCAAGGCAGCAGCAAGG - Intergenic
1041275369 8:56151880-56151902 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041314886 8:56550721-56550743 CGAACTGCAAGGCAGCAGCAAGG + Intergenic
1041388199 8:57326618-57326640 GGAACTGCAAAGCAGCAGCAAGG - Intergenic
1041685020 8:60635933-60635955 GGATATGCACTGCAGCACCATGG + Intergenic
1042682266 8:71399013-71399035 TGAACTGCAAGGCAGCAGCAAGG - Intergenic
1042731455 8:71939564-71939586 GGAACTGCAAGGCAGCAGCGAGG - Intronic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1043553911 8:81407251-81407273 GGAAATGAACCTCAGCAACATGG - Intergenic
1044523570 8:93226538-93226560 AGTAGAGCACAGCAGCAGCAGGG - Intergenic
1045241093 8:100402219-100402241 GGAACTGCAACGCAGCAGCGAGG + Intronic
1045788700 8:105956078-105956100 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1046811233 8:118535666-118535688 GGAAGTGCAAGGCGGCAGCATGG - Intronic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1050586583 9:7118723-7118745 AGAAACCCACAGCACCAGCAAGG - Intergenic
1051327492 9:15988851-15988873 CGAAGTGCAAAGCGGCAGCAGGG + Intronic
1052697175 9:31892526-31892548 AGAAATCCCCAGCGGCAGCATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053000920 9:34577027-34577049 GCAGATGCCCAGCAGCAGGAGGG + Intronic
1053041654 9:34878637-34878659 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1053147626 9:35722656-35722678 TGAATTGCACAGCAAAAGCAGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053647444 9:40131580-40131602 GGCACTGCACAGCAGCATCCTGG - Intergenic
1053688801 9:40569145-40569167 GGCCAGGCACAGCATCAGCAAGG - Intergenic
1053758283 9:41332263-41332285 GGCACTGCACAGCAGCATCCTGG + Intergenic
1054275236 9:63061919-63061941 GGCCAGGCACAGCATCAGCAAGG + Intergenic
1054300041 9:63370056-63370078 GGCCAGGCACAGCATCAGCAAGG - Intergenic
1054328426 9:63729534-63729556 GGCACTGCACAGCAGCATCCTGG - Intergenic
1054399594 9:64703019-64703041 GGCCAGGCACAGCATCAGCAAGG - Intergenic
1054433177 9:65187284-65187306 GGCCAGGCACAGCATCAGCAAGG - Intergenic
1054497206 9:65834391-65834413 GGCCAGGCACAGCATCAGCAAGG + Intergenic
1054537135 9:66244590-66244612 GGCACTGCACAGCAGCATCCTGG + Intergenic
1055336174 9:75235696-75235718 GTATATGTACAGCATCAGCAGGG + Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056902593 9:90613597-90613619 GGAGATGGACAGCCGCTGCATGG + Exonic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057934259 9:99223199-99223221 GCAAATGCAAAGCAGTAGAAAGG - Intronic
1059675715 9:116537074-116537096 CGAACTGCAAGGCAGCAGCAAGG - Intronic
1059898237 9:118892472-118892494 AGAAATGCACTGCAGCTGCCTGG + Intergenic
1060662205 9:125411055-125411077 GGAGGTGCACAGTAGCTGCAGGG + Intergenic
1060964619 9:127705717-127705739 GGCAATGTCCAGCAGGAGCAGGG + Intronic
1061246592 9:129403898-129403920 GGGTATGCACCGCAGCTGCAGGG - Intergenic
1061476786 9:130872962-130872984 GGCCATGTACAGCAGCACCACGG - Exonic
1061737837 9:132674526-132674548 GGTAACCCAAAGCAGCAGCACGG - Intronic
1061995581 9:134181195-134181217 GGAATTGCAGGGCTGCAGCAGGG + Intergenic
1062302436 9:135882380-135882402 GAAAAGGCACACCAGTAGCAAGG + Intronic
1062347495 9:136122111-136122133 AGCAATGGGCAGCAGCAGCAGGG - Intergenic
1062424155 9:136498305-136498327 GGAAACCAACAGCAGCTGCAGGG + Intronic
1202795229 9_KI270719v1_random:114877-114899 GGCACTGCACAGCAGCATCCTGG - Intergenic
1203573190 Un_KI270744v1:151877-151899 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1186392936 X:9179617-9179639 GCAACTTCCCAGCAGCAGCATGG - Intergenic
1186982748 X:14974719-14974741 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
1187374513 X:18739853-18739875 TGAACTGCAAGGCAGCAGCAAGG - Intronic
1188035726 X:25315571-25315593 CGAACTGCAAGGCAGCAGCAAGG - Intergenic
1189045627 X:37587514-37587536 CGAACTGCACGGCAGCAGCAAGG - Intronic
1189563366 X:42213955-42213977 GGAAATGCAGAGCACGAGCTTGG + Intergenic
1190495599 X:51025740-51025762 GGAGAAGCACAGCATCAGCCCGG + Intergenic
1190510327 X:51167841-51167863 GGAGAAGCACAGCATCAGCCCGG - Intergenic
1190608635 X:52171188-52171210 CGAACTGCAATGCAGCAGCAAGG + Intergenic
1191692861 X:63958871-63958893 GGAAATGGACAAGAGCCGCAGGG + Intergenic
1192488922 X:71556716-71556738 GCAAGTGTACTGCAGCAGCAGGG + Exonic
1194423305 X:93704115-93704137 GGAAATACATAGCTCCAGCAAGG - Intronic
1194448780 X:94016810-94016832 GGAAATTCCCAGCAGCTACAGGG - Intergenic
1194491269 X:94552547-94552569 GGAAAATCACAGAAGCAGCAAGG - Intergenic
1195114979 X:101688224-101688246 GAGCAGGCACAGCAGCAGCAGGG - Intergenic
1195302261 X:103542248-103542270 GGAAAAGCTGAGCAGCATCAGGG + Intergenic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1196744312 X:119055834-119055856 GGAAAGCAGCAGCAGCAGCAAGG + Intergenic
1197884203 X:131201055-131201077 GGAACAGCACAGAAGCAGCCTGG - Intergenic
1198168376 X:134079870-134079892 TGAACTGCAAGGCAGCAGCAAGG + Intergenic
1198265199 X:135002393-135002415 GCAAATTCATAGCAACAGCAAGG - Intergenic
1200250841 X:154552936-154552958 GGCAATGCAGAGCAGTGGCAGGG - Intronic
1200280884 X:154775951-154775973 GAAGGAGCACAGCAGCAGCACGG - Intronic
1200304240 X:155008423-155008445 GGCAATGCAGAGCAGTGGCAGGG + Intronic
1202085201 Y:21129236-21129258 TGAACTGCAAGGCAGCAGCAAGG - Intergenic