ID: 1005505904

View in Genome Browser
Species Human (GRCh38)
Location 6:26468635-26468657
Sequence TTGTGTGACCAGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005505904 Original CRISPR TTGTGTGACCAGAGGGGAGG AGG (reversed) Exonic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900337111 1:2169738-2169760 GGGTGTGCGCAGAGGGGAGGTGG + Intronic
900471727 1:2858313-2858335 TTGTGGAACTAGAGGGGTGGGGG - Intergenic
900608742 1:3535590-3535612 ATGTGAGGGCAGAGGGGAGGTGG - Intronic
901846364 1:11985197-11985219 TTCTGTGACCAAATGTGAGGGGG - Intronic
902082028 1:13827775-13827797 TTGTGAGATGAGAGGGGATGTGG - Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
904345519 1:29866315-29866337 TTCTGGGAGCAGAGGGGAGAGGG - Intergenic
906117965 1:43368024-43368046 TTCTGTCACCAGAGGGGGAGGGG + Intronic
907544672 1:55249370-55249392 TTTAGTGAAAAGAGGGGAGGTGG - Intergenic
907609299 1:55851779-55851801 TTGTGTTTTCAGAGTGGAGGTGG - Intergenic
907865240 1:58392909-58392931 TTGTGTAGCCTGAGAGGAGGAGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911754819 1:101541295-101541317 TTGATTGACCAAAGGGGTGGGGG - Intergenic
912707513 1:111925926-111925948 TTTTGTGATCAGTGGGGAGGGGG - Intronic
915285920 1:154851947-154851969 TTGTGAGGTCACAGGGGAGGCGG - Intronic
915914096 1:159930941-159930963 ATGGTTGAGCAGAGGGGAGGTGG - Intronic
921182980 1:212645963-212645985 TTGAGGGGCCAGTGGGGAGGAGG + Intergenic
921343480 1:214157683-214157705 ATGTGTGAACAGTGGAGAGGAGG - Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
922317543 1:224456196-224456218 TGGTGTGAGGAGAGGGGAGCAGG - Intronic
922466160 1:225846597-225846619 GTGTGTGCTCAGAAGGGAGGAGG + Exonic
922994028 1:229941717-229941739 TTGTGTGACAAAAGGGGTAGGGG + Intergenic
923225017 1:231931154-231931176 TTAGTTGACCAGAGGGGAGCAGG + Intronic
924859698 1:247908459-247908481 TTATGGGACCAGAGAAGAGGTGG + Intergenic
1063490080 10:6456042-6456064 TTCTGTGAAAAGGGGGGAGGTGG + Intronic
1063794787 10:9501282-9501304 GTGTGCTACCAGAGGGGTGGAGG - Intergenic
1064026120 10:11850133-11850155 GTGTGGGACCAGAAGGGAAGTGG + Intronic
1065386937 10:25143256-25143278 TTGGGTGACCACAGGACAGGTGG + Intergenic
1065434305 10:25691604-25691626 TGGTGTGAGCAGATGTGAGGTGG - Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1070428145 10:76309205-76309227 ATGTTTGATCAGCGGGGAGGAGG + Intronic
1070645322 10:78198118-78198140 TTGAGTGATCAGGGGAGAGGAGG + Intergenic
1071280816 10:84101026-84101048 TTCTGTGACCAGATGTGTGGAGG + Intergenic
1072551768 10:96483718-96483740 ATTTGTTACAAGAGGGGAGGAGG + Intronic
1072849150 10:98868360-98868382 TGGTGTGGGCAGCGGGGAGGTGG + Intronic
1073461722 10:103669280-103669302 TTGAGTGACCAGAAGAGATGAGG + Intronic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1077301813 11:1850879-1850901 TTGGGTAGGCAGAGGGGAGGAGG + Intergenic
1077394245 11:2313346-2313368 TTGTAAGACCACAGCGGAGGCGG + Intronic
1078441653 11:11373208-11373230 GTGAGTGACCAGAGGGTAAGGGG + Intronic
1081721856 11:45295151-45295173 TGGTGTGTACAGTGGGGAGGAGG - Intergenic
1084415767 11:69032192-69032214 TTTCCTGACCATAGGGGAGGGGG + Intergenic
1084719224 11:70893377-70893399 GGGGGTGACCACAGGGGAGGGGG + Intronic
1085475247 11:76784823-76784845 TGGAGTGAGCAGTGGGGAGGAGG - Intronic
1086136656 11:83448678-83448700 TTATGTGACAATGGGGGAGGGGG - Intergenic
1093373053 12:18387621-18387643 TGGTGTGAGAAGAGTGGAGGGGG - Intronic
1095946882 12:47758749-47758771 TTGGGTGAGTAGAGGGGTGGGGG + Intronic
1096629024 12:52913580-52913602 TTGTGTGCCCACAGGGTGGGGGG - Intronic
1102290190 12:111692921-111692943 TTGTGGGACTAGAGTGGTGGTGG + Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1103692161 12:122784062-122784084 TCGTGTGACCAGGGGTGAGGGGG - Intronic
1105948671 13:25210713-25210735 CTGTGTGACCCTAGGGCAGGAGG + Intergenic
1106534173 13:30624226-30624248 TTTTGTGACCAGATGTGTGGGGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1110755277 13:79166235-79166257 TTTTGTGACCAGAGAGGTTGTGG + Intergenic
1110760447 13:79224965-79224987 TTGAGTGAGAAGAGGGGACGAGG + Intergenic
1111926753 13:94471089-94471111 TACTATGACCATAGGGGAGGGGG + Intronic
1113338138 13:109396426-109396448 TGCTGTGACCACAGGGCAGGAGG + Intergenic
1113794252 13:113047801-113047823 AGGTGTGAGCAGAGGGGACGGGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115780974 14:36767867-36767889 TTGTCTCACCAGTGAGGAGGTGG + Intronic
1116516261 14:45810230-45810252 TCCTGTGACCAGAGAGGAAGAGG - Intergenic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1119090586 14:71777405-71777427 TTGTGTGTTCAGAGGTGAAGAGG + Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121758529 14:96423584-96423606 TTGTCTGTCCAAAGGGGAGTGGG + Intronic
1124072691 15:26410614-26410636 TTGTGTGATCCGAGGGCACGCGG - Intergenic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1124649398 15:31463757-31463779 TTCTGTGACCAAAGGCGTGGAGG - Intergenic
1124836362 15:33199311-33199333 TTCTGTGACCAAAGGTGTGGGGG - Intergenic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1126872066 15:53000577-53000599 TTGTGTCACCAGTGTGCAGGGGG + Intergenic
1127077626 15:55343439-55343461 TTGTGTGCCTGGAGGGGACGGGG + Intronic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1128289065 15:66462978-66463000 TTCTCTGTCCAGAGGGCAGGAGG + Intronic
1128894825 15:71363209-71363231 TTGTGTGACCACAGCAGAGTTGG - Intronic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130213191 15:81945140-81945162 TCGTGAGACCGCAGGGGAGGAGG - Intergenic
1132781670 16:1629969-1629991 TGGAGGGGCCAGAGGGGAGGTGG - Intronic
1133778247 16:8915024-8915046 TCCTGTGAGGAGAGGGGAGGTGG + Intronic
1134446920 16:14337963-14337985 TTGTGTGGGAAGAGGGGTGGCGG - Intergenic
1135063328 16:19289227-19289249 CTCTGTGACCATAGAGGAGGAGG - Intronic
1135844654 16:25908046-25908068 TTGTGATAGAAGAGGGGAGGGGG + Intronic
1135932241 16:26747907-26747929 ATGTGGGAGCAGAGAGGAGGGGG - Intergenic
1136060899 16:27725807-27725829 TGGTGTGACCAGGCTGGAGGCGG - Intronic
1136138881 16:28276158-28276180 TTGTTTGAGGAGAGAGGAGGAGG + Intergenic
1136229094 16:28876605-28876627 TGCTGTGACCTGAGGGGAGTGGG - Intergenic
1136568310 16:31082710-31082732 TTGTCAGAGCAGAGGGCAGGTGG + Intronic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1137938301 16:52656758-52656780 TTCTGTGAGCAGTTGGGAGGGGG - Intergenic
1139780609 16:69348452-69348474 TTGTGTGTGCGGGGGGGAGGGGG + Intronic
1139927833 16:70501175-70501197 TTATGGGCCCAGTGGGGAGGGGG - Intronic
1140471615 16:75218687-75218709 TTCTGTTCCCAGAGGGGAAGTGG - Intergenic
1141525482 16:84608462-84608484 TTGTGTGTCCACAGGGGCGTGGG - Intronic
1143479435 17:7220051-7220073 GTGTGTGACAAGAGGGACGGTGG + Intronic
1143485246 17:7250754-7250776 TTGTGTGTCAAGGGTGGAGGTGG - Intronic
1143858217 17:9868490-9868512 TTTTGTGACCAGATGGGGGTGGG - Intronic
1144621498 17:16821375-16821397 ATGTGGGAGCAGGGGGGAGGGGG + Intergenic
1144626679 17:16847469-16847491 TGGAAAGACCAGAGGGGAGGAGG - Intergenic
1145152482 17:20519144-20519166 TGGAAAGACCAGAGGGGAGGAGG - Intergenic
1145270125 17:21400383-21400405 CTGTGTGACCACCCGGGAGGAGG - Intronic
1145308353 17:21687834-21687856 CTGTGTGACCACCCGGGAGGAGG - Intergenic
1146910464 17:36645433-36645455 GGGTAGGACCAGAGGGGAGGGGG - Intergenic
1146948684 17:36891037-36891059 TTATGTGGCCAGGGGGCAGGGGG + Intergenic
1147599579 17:41737635-41737657 TTGGGAGACCAAGGGGGAGGCGG - Intergenic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1150176513 17:63062819-63062841 TTCTGTGACCAGATGTGTGGGGG + Intronic
1150291134 17:63983091-63983113 TTGGTTGGCAAGAGGGGAGGTGG - Intergenic
1150713067 17:67548049-67548071 TTGTCTCAACAGAGGCGAGGTGG - Intronic
1152330250 17:79668680-79668702 GTTTGGGATCAGAGGGGAGGAGG - Intergenic
1152442923 17:80320175-80320197 GTGGGTGACTAGAGGGGAGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155667896 18:28333775-28333797 TTGGGTGACAATAGGGGAAGGGG + Intergenic
1156457872 18:37304864-37304886 TTGAGGGTCCAGAAGGGAGGGGG + Intronic
1158222263 18:55161790-55161812 TTGTGTGAACAGAGAGGATTGGG - Intergenic
1160426737 18:78783093-78783115 TTCTGCCACCAGAGAGGAGGAGG + Intergenic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160766716 19:812041-812063 TTGTGAGACCCGAGGGGCGGCGG + Exonic
1163801779 19:19370184-19370206 TGGAGTGGCCAGAGAGGAGGGGG - Intergenic
1163897047 19:20068436-20068458 TTGGGTTTACAGAGGGGAGGGGG - Intergenic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164753321 19:30671625-30671647 CTCAGTGACCAGAGGTGAGGAGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165137192 19:33677142-33677164 TTGTGTGATCAGCCGGCAGGGGG + Intronic
1166275458 19:41750471-41750493 TTGTGTGTCCATCGGGAAGGTGG - Intronic
1166396260 19:42443512-42443534 TTGTGTGTCCATCGGGAAGGTGG + Intergenic
1166644683 19:44522856-44522878 TGGTGTTGCCAGTGGGGAGGTGG - Exonic
1167106437 19:47432437-47432459 TCGTGTGCCCACAGGGGACGAGG - Exonic
1167608850 19:50496565-50496587 GTGTGTGAGGAGAGGCGAGGAGG + Intergenic
1167842255 19:52131625-52131647 TTCTGTGAGCTAAGGGGAGGAGG + Intronic
1168084762 19:54037464-54037486 TCGTGTGATCACAGGAGAGGGGG - Intergenic
1168536556 19:57175086-57175108 TTGTGTGACCAAATGAGTGGAGG - Intergenic
925462681 2:4077313-4077335 GTGGGTGATAAGAGGGGAGGTGG - Intergenic
926143727 2:10384307-10384329 TTGTGGGAGGAGAGGGGTGGAGG + Intronic
927073738 2:19555788-19555810 TTCTGAGACCAGAGGTGAGGAGG + Intergenic
928228390 2:29475327-29475349 CTGTGTTACCTGAGGGGATGTGG - Intronic
928410691 2:31051909-31051931 TTGGGTGGGCGGAGGGGAGGGGG - Intronic
931074842 2:58699208-58699230 TTGTGTGGGAAGAGGAGAGGTGG - Intergenic
934912445 2:98272016-98272038 TTCTGTGACCAAAGGTGTGGGGG + Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935686344 2:105687456-105687478 TGATGTGACCAGAGGTGGGGAGG - Intergenic
936547953 2:113409099-113409121 TTGTGAGTCCAGAGAGGAGAAGG + Intergenic
936657339 2:114503642-114503664 TTGTGGGACAAGAAGGGAAGGGG + Intronic
936855527 2:116953245-116953267 TGGTGGGACCAGAAGGAAGGAGG + Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
939081972 2:137673524-137673546 TTCTGAAACCAGAGTGGAGGAGG + Intronic
939560456 2:143725585-143725607 TTGTGGAACCACAGGGAAGGAGG - Intronic
940807925 2:158208600-158208622 TCATGAGACCACAGGGGAGGAGG + Intronic
941419477 2:165264605-165264627 GTGTGTGACAAGGTGGGAGGAGG - Intronic
941574399 2:167212900-167212922 GTGTGTGTGCAGAGGGGTGGGGG - Intronic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
942985165 2:182132047-182132069 TTGTGTGGCCAGAGAGGGAGAGG - Intergenic
944344988 2:198652642-198652664 TTGTGTGACAAGGGGGGAGCTGG - Intergenic
945721491 2:213422664-213422686 TTGTGTGTACAGAGGGTGGGAGG - Intronic
947200877 2:227613507-227613529 TTGGGTGAGCAGTGGGGCGGGGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948426008 2:237886924-237886946 TCGAGTGTCCACAGGGGAGGCGG - Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
949028540 2:241777467-241777489 TTCTGTAAACAGAGGGGAGGTGG + Intronic
1169123565 20:3111525-3111547 TGGTGTGAAGAGAGGTGAGGAGG - Intronic
1170161657 20:13319729-13319751 GTGTGTGTGCAGGGGGGAGGGGG - Intergenic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171188570 20:23141775-23141797 GAGTGTGATCTGAGGGGAGGTGG + Intergenic
1171485362 20:25481845-25481867 TGCTGTGACCTGAAGGGAGGTGG - Intronic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174346404 20:49933373-49933395 TTGCGTGACCAAAGAAGAGGAGG + Intergenic
1178701807 21:34840295-34840317 TTGTTTCTCTAGAGGGGAGGAGG - Intronic
1179277897 21:39908517-39908539 TTGTCAGACCAGGAGGGAGGAGG + Intronic
1180749373 22:18113750-18113772 TTTTGTGATGGGAGGGGAGGAGG - Intronic
1181015300 22:20065220-20065242 TTCTGTGGCCACAGGAGAGGAGG - Exonic
1183283525 22:36947621-36947643 CTGAGTGACGAGATGGGAGGAGG - Intergenic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184245135 22:43231923-43231945 TTGTGTGACCAGCGGGGGGACGG + Intronic
1184540841 22:45123241-45123263 TTATCTGTCCAGAGGGGAGAAGG + Intergenic
1184779306 22:46638394-46638416 TTGTGTCTCCAGGAGGGAGGTGG + Intronic
949371358 3:3338000-3338022 TTGCGTGACCAGATGGTAGAGGG - Intergenic
950023804 3:9807118-9807140 GTGTGTGAAAGGAGGGGAGGTGG + Intronic
950139113 3:10602986-10603008 TTGAGAGAACAGAGGGGATGTGG - Intronic
950399284 3:12758525-12758547 TGGTGTGGCCCAAGGGGAGGGGG - Intronic
950691965 3:14666218-14666240 TGGGCTGACCAGATGGGAGGTGG - Intronic
950877963 3:16294971-16294993 TTGTGAACCCAGAGGGCAGGAGG - Exonic
951823304 3:26838398-26838420 CTATGTGACGAGAGAGGAGGGGG + Intergenic
952387417 3:32852277-32852299 TTCTCTGACCAGAGGGAGGGTGG + Intronic
952976060 3:38697567-38697589 ATGTGTGCCCAGAGCTGAGGAGG - Exonic
953069670 3:39506565-39506587 TTATCTTACCAGAGGGGTGGAGG + Intronic
953197321 3:40746627-40746649 GTATGTGCCCAGTGGGGAGGAGG + Intergenic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954917966 3:54164676-54164698 CTTTGTGACCAGTGGGGATGGGG + Intronic
955612301 3:60770471-60770493 TTGTGTGGCCTGAGAAGAGGAGG - Intronic
960349618 3:116576410-116576432 GTGGGTGACCACAGTGGAGGAGG + Intronic
960501868 3:118447497-118447519 TTGTGTGACAAGAGTGGATATGG - Intergenic
963206678 3:142643249-142643271 TAGAGTGATCAGAGAGGAGGTGG + Intronic
969721927 4:8896775-8896797 TTGTGTGTGCAGAGGCTAGGTGG - Intergenic
971363352 4:25956540-25956562 TTCTGTGACCAGATGTGTGGGGG - Intergenic
973204019 4:47539849-47539871 TTCAGTGACTAGAGTGGAGGAGG - Intronic
973878002 4:55241023-55241045 TTCTGGGAGCAGAGGGGATGAGG - Intergenic
975536818 4:75459793-75459815 TTTGGTGACCAGAGGGGAATAGG + Intergenic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
977790786 4:101099998-101100020 TTATGTGACCTGAGGAGAGTGGG + Intronic
978885449 4:113761849-113761871 GTGTGGGACCAGCGAGGAGGGGG - Intronic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
981896258 4:149803984-149804006 TTGTATCACCTAAGGGGAGGAGG - Intergenic
981916353 4:150037826-150037848 TGGGGTGGCCAGAGGGGAAGTGG + Intergenic
983308551 4:166025410-166025432 TTCTGTGACCCCAGGGGAGAAGG + Exonic
984604268 4:181766525-181766547 TGGGGTGAGCAGAGTGGAGGTGG + Intergenic
985121187 4:186643696-186643718 TTGTATGGCCAGAGTGCAGGGGG - Intronic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
986960739 5:13208568-13208590 TGGTGTTACTAGAGGGTAGGAGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987249002 5:16079846-16079868 TCCTGTGTCCTGAGGGGAGGTGG - Intronic
987885541 5:23807211-23807233 ATGAGTGACCTCAGGGGAGGAGG + Intergenic
993017338 5:82549853-82549875 TTGTGGGACCATAGGGATGGTGG + Intergenic
993462765 5:88204641-88204663 GTGTGTGTGCAGAGAGGAGGGGG + Intronic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
995423788 5:111996331-111996353 TTGTGTGTCCAGGGGAGAAGAGG - Intronic
995713234 5:115055626-115055648 TTGAGTGACCAAAGAGGAAGGGG - Intergenic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
996537303 5:124591915-124591937 TGGGGTTACCAGAGTGGAGGCGG - Intergenic
996928291 5:128855459-128855481 GTGTGTGCCCAGATGGGAGCTGG + Intronic
997429376 5:133826969-133826991 TTCTGTGGTGAGAGGGGAGGAGG - Intergenic
997859775 5:137405910-137405932 ATGGGTGAACAGAGGAGAGGTGG - Intronic
998074118 5:139222340-139222362 TTGTGTGGCCACCGAGGAGGAGG + Intronic
998416741 5:141951710-141951732 TTGTGTGATCAGATGGGGGATGG + Intronic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
1000362663 5:160462311-160462333 TGTTGTGACCAGAGGGTTGGAGG - Intergenic
1001328063 5:170744030-170744052 TTGTGTGAACAGCAGGGGGGAGG - Intergenic
1001495586 5:172185947-172185969 GTGTGGGCTCAGAGGGGAGGTGG + Intronic
1001803498 5:174563941-174563963 TTGTGGGACTGGAGTGGAGGTGG + Intergenic
1001913422 5:175540092-175540114 GTGTGAGAGCAGAGGGGTGGAGG + Intergenic
1002322944 5:178386572-178386594 GTGTGTCACCAGAGGGGGGTCGG + Intronic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1002586383 5:180251532-180251554 CTGTGTGGCCAATGGGGAGGTGG + Intronic
1003163055 6:3652305-3652327 TTGTGTGTCGAGAGGGGGTGAGG - Intergenic
1004005939 6:11637229-11637251 TTGTGTGGAAAGAGAGGAGGAGG + Intergenic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005498904 6:26412968-26412990 TCTTGTGTCCAGAGGGGAAGAGG - Intronic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1006984209 6:38166722-38166744 TTCTGTGCGGAGAGGGGAGGTGG - Intergenic
1007147831 6:39654340-39654362 CTCTATGACCAGAGAGGAGGAGG - Intronic
1008136471 6:47783261-47783283 TTGGGTGACCAGTGTGAAGGTGG + Intronic
1011049773 6:83132191-83132213 TTGTGGGACCAGTTGGGAGATGG + Exonic
1011381100 6:86743119-86743141 TTCTGTGACCAAATGGGTGGGGG + Intergenic
1014327926 6:120022725-120022747 TTGAGTAATCTGAGGGGAGGTGG - Intergenic
1017137582 6:151161796-151161818 TTATGTTAACAGAGGGGAGATGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018818874 6:167357658-167357680 GTCGGTGACCAGAGGGGAGCAGG + Intronic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1021148628 7:17121008-17121030 TTGAGAGACCAGTGAGGAGGGGG - Intergenic
1022008371 7:26288198-26288220 TTCTGTGACCAAAGGTGTGGAGG + Intergenic
1022959596 7:35413762-35413784 TCCTGGGACCAGAGGAGAGGAGG - Intergenic
1026441731 7:70450838-70450860 TTTTGTGACCACTGGGAAGGGGG + Intronic
1027500743 7:78947271-78947293 TTGGGTGAGGTGAGGGGAGGAGG - Intronic
1030951932 7:115801879-115801901 TTGTGTGACAAGAGAGGAAAAGG - Intergenic
1031112046 7:117622800-117622822 TTGTGTGACAAGGAGGGAAGAGG - Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1035395432 7:158531774-158531796 TTCTATGAGCAGAGGGCAGGTGG - Intronic
1036922007 8:12865417-12865439 TAGTTTGATCAGAGGGTAGGGGG + Intergenic
1038024766 8:23578533-23578555 TTGAATGAGCAGAGAGGAGGTGG - Intergenic
1038985267 8:32802309-32802331 TTCTGTGACCAGATGTGTGGGGG + Intergenic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039567251 8:38560293-38560315 TTGTCTGACCCCAGGGGAAGAGG - Intergenic
1040054928 8:43049262-43049284 TGGAGTGACCAGATGGGAGTGGG - Intronic
1040525020 8:48214579-48214601 TTGTGGGGCCAGGGGGGAGTTGG - Intergenic
1040633051 8:49238717-49238739 TTATGTCACCAGGTGGGAGGTGG + Intergenic
1040718027 8:50282148-50282170 TTCTCTGGCCAGAGGGGAGCTGG - Intronic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1043387510 8:79763159-79763181 TTTTTTCACCAGATGGGAGGAGG + Intergenic
1047648157 8:126890654-126890676 TTGTGTGACCACAGGAAAGCTGG - Intergenic
1047821735 8:128528640-128528662 TTGTGTGATCATAGGCGTGGTGG - Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1049133834 8:140875457-140875479 TGATGTCACCAGAGTGGAGGAGG + Intronic
1049532525 8:143161494-143161516 TTGTGGCTCCAGAGGGGTGGAGG + Intergenic
1050732041 9:8720107-8720129 ATGAGTGACCACATGGGAGGTGG - Intronic
1051414877 9:16828978-16829000 ATGTGTGAGCAGGGGGGCGGCGG + Intronic
1051769356 9:20559410-20559432 TTGTGAAAGCAGAGGGGTGGGGG + Intronic
1053117752 9:35520421-35520443 TTGTGGGGCCAGGGTGGAGGAGG - Intronic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056307564 9:85305194-85305216 TTGATTGACCAGAATGGAGGTGG + Intergenic
1056331160 9:85522462-85522484 GTGTGTGTCCAGAGGGCTGGTGG - Intergenic
1057698850 9:97348566-97348588 TAGTGGGATCAGATGGGAGGTGG + Intronic
1057711767 9:97451880-97451902 TTGTGTGACCAAATGGGTGGGGG - Intronic
1057796418 9:98161174-98161196 TGGTGTGGCCACAGAGGAGGAGG + Intronic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1058864245 9:109146518-109146540 TTCTGTGACCAGATGTGTGGGGG - Intronic
1059193631 9:112349961-112349983 TTCTGTGACCAGATGTGTGGGGG - Intergenic
1059539575 9:115117290-115117312 TTCTGTGATGAGAGGTGAGGAGG + Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1060895845 9:127216802-127216824 TGGTGTGACCAGTATGGAGGAGG - Intronic
1061260029 9:129475118-129475140 TTCTGTTACCAAAGGGGAGGTGG - Intergenic
1062467018 9:136686008-136686030 GTGTGTGACCAGTGGTGATGTGG - Intronic
1185457116 X:316797-316819 TTGCGGGGCCAGAGGGGAAGCGG - Intronic
1186794271 X:13029442-13029464 TTCTGTAACCAGAGGAGGGGAGG + Intergenic
1187389079 X:18874030-18874052 TTGAGTAACCAGAGTGGAAGAGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1192271858 X:69588413-69588435 GTGTGTGACCAGAGGTGGAGGGG - Intergenic
1196650333 X:118161847-118161869 GGGAGTGACCAGAGGAGAGGTGG + Intergenic
1198168060 X:134077255-134077277 TTTTGTGACCAGAGAGGGTGGGG - Intergenic