ID: 1005510635

View in Genome Browser
Species Human (GRCh38)
Location 6:26508956-26508978
Sequence AGGCAAAAGAAGGGCCGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005510635_1005510647 25 Left 1005510635 6:26508956-26508978 CCCCTCCGGCCCTTCTTTTGCCT 0: 1
1: 0
2: 4
3: 61
4: 426
Right 1005510647 6:26509004-26509026 ACCATCTGCCCAATTGCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 141
1005510635_1005510649 26 Left 1005510635 6:26508956-26508978 CCCCTCCGGCCCTTCTTTTGCCT 0: 1
1: 0
2: 4
3: 61
4: 426
Right 1005510649 6:26509005-26509027 CCATCTGCCCAATTGCTGATGGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005510635 Original CRISPR AGGCAAAAGAAGGGCCGGAG GGG (reversed) Exonic
900231539 1:1561371-1561393 AGACAAAGGACGGGCCGGCGCGG - Intronic
900339713 1:2182288-2182310 AGGAAAATGCAGGGCAGGAGGGG - Intronic
901027404 1:6285846-6285868 AGGCATGAGAAGGGCAGGAAGGG + Intronic
901421542 1:9154513-9154535 AGGCACCAGAAGGACAGGAGGGG + Intergenic
902629166 1:17694698-17694720 AGGCATAAGTAGGGCCGGGTGGG - Intronic
902782873 1:18716053-18716075 AGGAGAGAGAAGGGCCGGTGGGG - Intronic
903367859 1:22816034-22816056 GGGGAAAAGAAGGCCCAGAGAGG - Intronic
903392176 1:22972409-22972431 AGGCAAAAAGAGGTCCTGAGGGG + Intergenic
905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG + Intergenic
906290769 1:44617948-44617970 AGGCAAAGGCAGGGTAGGAGAGG - Intronic
907166569 1:52416658-52416680 AGCCACAAGAAGAGCCGGAGAGG + Exonic
908082704 1:60598320-60598342 AGGGAAAAGAAGGGAAGGAAAGG + Intergenic
908643537 1:66251691-66251713 AGGCAGAGGAAGTGCAGGAGAGG + Intronic
908658560 1:66414054-66414076 AAGCAAAAGAAGGGTTGGGGTGG - Intergenic
908994193 1:70132039-70132061 AGACAAAAGAAGGGCAATAGAGG + Intronic
909100568 1:71343183-71343205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
910195873 1:84638980-84639002 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
910461674 1:87454151-87454173 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
910683495 1:89891838-89891860 AGGGAAAGGAAAGGCTGGAGAGG - Intronic
911176482 1:94822726-94822748 AGGAAAAGGCAGGGCAGGAGAGG - Intronic
911485645 1:98501571-98501593 TGGCATAAGCAGGGCAGGAGAGG + Intergenic
911862501 1:102970723-102970745 AGGCAAAAGAAGGCCGGGCAGGG + Intronic
912769458 1:112450230-112450252 AGCCAAATGAAAGGCCAGAGTGG + Intronic
914318895 1:146540444-146540466 AGGCATAAGCAGGGCAGGAGTGG - Intergenic
914495463 1:148192913-148192935 AGGCATAAGCAGGGCAGGAGTGG + Intergenic
915641730 1:157232783-157232805 AGACAGAAGCAGGGCAGGAGAGG - Intergenic
915899760 1:159837953-159837975 AAGCAAAAGAAGATCTGGAGAGG - Exonic
916973302 1:170048025-170048047 AGGAATTAGAAGGGCAGGAGTGG + Intronic
917098725 1:171425254-171425276 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
917186120 1:172358045-172358067 AGGCAGAAGAAGGAGAGGAGTGG - Intronic
917734698 1:177909757-177909779 AGGGAAAAGAAGGGGAGGGGAGG + Intergenic
917996829 1:180448484-180448506 AGGAAAAAGAAGAACCAGAGGGG - Intronic
918324469 1:183396238-183396260 AGGCATGAGCAGGGCAGGAGAGG + Intronic
918623491 1:186632153-186632175 AGACAAAAGAAGGGATTGAGAGG + Intergenic
918815220 1:189172429-189172451 TGGCAAAAGAAGTGCAGGAGGGG + Intergenic
918926008 1:190787184-190787206 AGGCAAGAGAAGGGATGGAAAGG - Intergenic
918952744 1:191160682-191160704 AGGGAAAGGAAGGGAAGGAGAGG + Intergenic
919298438 1:195732207-195732229 AGACATAAGAAGGACAGGAGAGG + Intergenic
919763441 1:201112239-201112261 AGGCAGAACAAGGCCCGGGGTGG + Exonic
920447095 1:206026019-206026041 AGGCAACAGGAAGGCCCGAGGGG - Intergenic
920512951 1:206564359-206564381 AGACAGAAGGAGGGCAGGAGGGG - Intronic
921101189 1:211930827-211930849 AGGAAAAAGAAGGGCCAGGAGGG + Intergenic
921599111 1:217088756-217088778 AGGGAAAAGAAAGGGAGGAGGGG + Intronic
922252200 1:223859674-223859696 AGGCAGAAGAAAGGCCAGAATGG + Intergenic
922355758 1:224773775-224773797 ATGGGAAAGAAGGGCTGGAGGGG + Intergenic
922806604 1:228393547-228393569 AGGCAAAGTAAGGGCCGGGACGG - Intergenic
922809599 1:228408262-228408284 AGGCAGAAGAAAGGCTGCAGGGG + Exonic
922875319 1:228935843-228935865 AGGCATGAGCAGGGCAGGAGGGG + Intergenic
923659271 1:235944551-235944573 GAGCAAAAGGAGGCCCGGAGAGG + Intergenic
923661168 1:235958584-235958606 AGACACAAGCAGGGCAGGAGAGG - Intergenic
923888027 1:238179881-238179903 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
924465138 1:244292699-244292721 AGGCAGAAGATGGGAAGGAGTGG + Intergenic
924470536 1:244339245-244339267 AGTGAAGAGAAGGGCCGGGGAGG + Intergenic
924929771 1:248719734-248719756 AGGCAAGAGAAGGCCGGGCGCGG + Intronic
1063678365 10:8162165-8162187 AGCCACAAGAAGAGCCGGAGAGG + Intergenic
1064596837 10:16953881-16953903 AGGAAAAGGAAGGGGAGGAGAGG + Intronic
1064775892 10:18777103-18777125 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065506428 10:26434509-26434531 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065506717 10:26437057-26437079 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1065534927 10:26707456-26707478 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1066780626 10:38942157-38942179 AGGCAAAAGCCGTGGCGGAGGGG - Intergenic
1067438786 10:46296696-46296718 AGGAAAAGGCAGGGCTGGAGAGG + Intronic
1067742458 10:48905942-48905964 TGGCAAGAGAAGGGCTGGAAAGG - Intronic
1068184702 10:53569806-53569828 AGGGAAAAGGAGGGGAGGAGAGG + Intergenic
1068600790 10:58954353-58954375 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1070501119 10:77073354-77073376 AGGGAAAAGAAGGGCAAGACTGG - Intronic
1070847376 10:79534319-79534341 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1070926421 10:80225973-80225995 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1071579652 10:86757123-86757145 AGACAAAAGAGGGGCCGGCGGGG - Intronic
1071790674 10:88951072-88951094 AGGGAAAAGAAGGGTGGGAAAGG - Intronic
1071870853 10:89792895-89792917 AGGAAAAAGCAGTGCCTGAGCGG + Intergenic
1072356631 10:94617906-94617928 AGGCATAAGTGGGGCAGGAGAGG - Intergenic
1072509847 10:96109951-96109973 AGGAAAAAAAAATGCCGGAGAGG - Intergenic
1072519997 10:96222865-96222887 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1072531281 10:96321790-96321812 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1073630067 10:105139523-105139545 AGGCAAAGGGAGGGTTGGAGAGG + Intronic
1073834572 10:107426272-107426294 AAGCAAAAGAAGGACCAAAGAGG - Intergenic
1074002564 10:109387495-109387517 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1074412776 10:113242649-113242671 AGGGAAAGGAAGGGATGGAGTGG - Intergenic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1079234565 11:18678881-18678903 AGGCATAAGCAGGGCAGGAGGGG + Intergenic
1079378193 11:19913283-19913305 AGGAAATAGAAGGGCAGAAGAGG - Intronic
1079469591 11:20765605-20765627 AGGCAAAATAATGGCCTGACCGG + Intronic
1081029098 11:38055497-38055519 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1081159088 11:39731781-39731803 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1082175461 11:49053727-49053749 AAGCAAAAGAAAGGCCTCAGAGG + Exonic
1082192713 11:49266798-49266820 AGGCAAGAGCATGGCAGGAGAGG + Intergenic
1082261195 11:50077257-50077279 AGGCAAAAGCTGGGCCAGAATGG + Intergenic
1082681235 11:56173373-56173395 TAGCAAAAGAAGGCCAGGAGCGG - Intergenic
1083025213 11:59545024-59545046 AAGCAAAAGATAGGCTGGAGAGG + Intergenic
1083249512 11:61456671-61456693 AGGCAGAAGCATGGCTGGAGAGG - Intronic
1083952604 11:65965240-65965262 AGGCAAGGGAAGGGCTGGGGAGG + Intronic
1084601565 11:70148885-70148907 AGGCTGAAGAAGGTCCCGAGAGG + Intronic
1084962609 11:72725172-72725194 AGTCACAGGAAGGGCCTGAGAGG + Intronic
1085107362 11:73857005-73857027 AGGGACAAGAAGGGGCGGAAAGG - Intronic
1086012376 11:82120822-82120844 AGGCAAAACAGGGTCTGGAGTGG + Intergenic
1086690294 11:89782342-89782364 AAGCAAAAGAAAGGCCTCAGAGG - Intergenic
1086698357 11:89870634-89870656 AAGCAAAAGAAAGGCCTCAGAGG + Exonic
1086707806 11:89973854-89973876 AAGCAAAAGAAAGGCCTCAGAGG - Exonic
1086715561 11:90057615-90057637 AAGCAAAAGAAAGGCCTCAGAGG + Intergenic
1087066511 11:94032622-94032644 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1087431573 11:98062832-98062854 AGGGAAAAGAAGGGAAGGGGAGG + Intergenic
1087978694 11:104583861-104583883 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1088505221 11:110520948-110520970 AGGGAAAGGAAGGCCCAGAGAGG + Intergenic
1088874296 11:113921102-113921124 AGGAAAAAGATGGGCTGGACGGG - Intronic
1089123186 11:116155515-116155537 AGGGAAAGGAAGGGAAGGAGGGG + Intergenic
1089137857 11:116263840-116263862 AAGCAACAGAAGGGACGGAGGGG + Intergenic
1089199470 11:116715127-116715149 AGGGAAAGGGAGGGCTGGAGCGG + Intergenic
1090640552 11:128725944-128725966 AGGCAGAAGAGAAGCCGGAGGGG + Intronic
1091967875 12:4760820-4760842 AGGCAATATAAAGGCAGGAGTGG + Intronic
1093773295 12:23042339-23042361 AGGTAGAAGATGGGCCGGAAAGG - Intergenic
1094184433 12:27626056-27626078 GGGCAAAACAAGGGCAGGGGAGG - Intronic
1094697900 12:32839858-32839880 AGGCATAAGAAGTGCCTAAGTGG - Intronic
1096131221 12:49160431-49160453 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096648428 12:53050280-53050302 GGGCAAAAGAGGGGCAGGGGTGG + Intronic
1096779763 12:53985138-53985160 AGGAAAAAGAAGGGGAGGGGGGG - Intronic
1097796587 12:63869254-63869276 AGGCAAAGAAAGGGCAAGAGAGG + Intronic
1097931650 12:65193788-65193810 AGGTATAAGCAGGGCAGGAGAGG - Intronic
1098055679 12:66502952-66502974 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1098231829 12:68378919-68378941 AGGCGAAAGAAGGACAGGATGGG + Intergenic
1099437503 12:82661183-82661205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1099687722 12:85910745-85910767 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1099787199 12:87280866-87280888 TGGCAAAAAAACGGCGGGAGGGG + Intergenic
1100524463 12:95406538-95406560 AGGCAATGGGAGGGCCAGAGAGG + Intergenic
1100945932 12:99784092-99784114 GGGCAAAGGATGGGACGGAGAGG - Intronic
1102023776 12:109701537-109701559 AGGAAGAAGAAGGGCAAGAGGGG - Intergenic
1102933266 12:116878497-116878519 AAGCACAAGAAAGGCCGGAGCGG + Intronic
1103292191 12:119855553-119855575 AAGGAAAAGAAGTGCCCGAGAGG - Intronic
1106105357 13:26728318-26728340 AGGCAGATAAAGAGCCGGAGAGG + Intergenic
1107192012 13:37600178-37600200 ATTCAAAAGAAGAGCTGGAGAGG + Intergenic
1107338287 13:39379576-39379598 AGACAAAAGACGGCCCGGAAGGG - Intronic
1108578856 13:51811834-51811856 AGGCCAAAGAAAGGCAGGGGTGG + Intergenic
1112171044 13:96971904-96971926 AGGCATAAGTGGGGCAGGAGAGG - Intergenic
1117233225 14:53743744-53743766 AGAGAAGAGAAGAGCCGGAGAGG - Intergenic
1117528115 14:56631972-56631994 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1118947949 14:70406146-70406168 AGGCATAAGCAGGGCAGGAGGGG + Intronic
1118980557 14:70712944-70712966 AGGAAGAAGAAGGGCAGGAAGGG + Intergenic
1120267939 14:82275140-82275162 GGGCATAAGCAGGGCAGGAGAGG - Intergenic
1120429953 14:84401245-84401267 AGGTATAAGCAGGGCGGGAGAGG + Intergenic
1120939779 14:89936274-89936296 AGGAAAAAAAAGGACCTGAGTGG + Intronic
1121044210 14:90776108-90776130 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1121652999 14:95573811-95573833 AGACATAAGCAGGGCAGGAGAGG - Intergenic
1122119157 14:99542667-99542689 AGGCAACAGAAGGGCCACACTGG + Intronic
1122376180 14:101260599-101260621 AAGCAAAAGAAGGGACAAAGGGG - Intergenic
1122628727 14:103097776-103097798 AGGAAAGGGAATGGCCGGAGGGG + Intergenic
1202835765 14_GL000009v2_random:76532-76554 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1202837808 14_GL000009v2_random:91276-91298 AGGTAAAGGAAGAGCCAGAGTGG + Intergenic
1202907174 14_GL000194v1_random:81288-81310 AGGTAAAGGAAGAGCCAGAGTGG + Intergenic
1124436822 15:29657141-29657163 AGGCAGGAGAATGGCCGGAACGG - Intergenic
1126669458 15:51102986-51103008 AGGGAAGAGAAGGGGAGGAGAGG - Intronic
1128143985 15:65322172-65322194 AGGGAGAAGAAGGGGCTGAGAGG - Intergenic
1128243759 15:66119016-66119038 AGGCAAAAGGAGGGGAGGGGAGG - Intronic
1129698871 15:77756064-77756086 AGGCTAAGGCAGGGCTGGAGAGG + Intronic
1129826343 15:78637477-78637499 GGGAATAAGAGGGGCCGGAGAGG + Intronic
1131162787 15:90119060-90119082 AAGCAAAAGAAGGCCAGGCGTGG - Intergenic
1131312658 15:91304812-91304834 AGGAAAAAGAAGGACAGGAGAGG - Intergenic
1131578380 15:93614881-93614903 AGGGAAATGAAGGTCTGGAGCGG - Intergenic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1133609819 16:7422911-7422933 AGGGAAAAGGAGGGGTGGAGAGG - Intronic
1134077656 16:11303322-11303344 AGACATAAGCAGGGCAGGAGAGG + Intronic
1134449298 16:14353961-14353983 AGGCAAAGAAAGGGGAGGAGGGG + Intergenic
1135789057 16:25376669-25376691 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1136184028 16:28574575-28574597 AGGCAGGAGCAGGGCAGGAGAGG - Intronic
1136420895 16:30132216-30132238 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1136570063 16:31091348-31091370 AGGCAGAAGAGGGTCCGGTGTGG + Intronic
1137995486 16:53206241-53206263 AGGTAAAAGAAGGCCAGGTGTGG - Intronic
1138104812 16:54282362-54282384 AGGAAAAAGAGGGCGCGGAGGGG + Intergenic
1138727123 16:59152238-59152260 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1138743267 16:59334682-59334704 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1138748375 16:59389777-59389799 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1139649482 16:68355225-68355247 CGGCAGGAGAAGGGCCAGAGGGG - Intronic
1140026720 16:71297613-71297635 AGGAAAAAGGAGGGGAGGAGGGG - Intergenic
1141089733 16:81121905-81121927 ATGCAACAGAAGGGGCGGAGGGG + Intergenic
1141697079 16:85625199-85625221 GGGCAGATGAAGGGCTGGAGAGG - Intronic
1142278076 16:89133374-89133396 AGGCAGAAGATGGGGTGGAGTGG + Intronic
1142663418 17:1447196-1447218 AGGAAATAGAAGGGCGGGAAAGG + Intronic
1143794870 17:9328329-9328351 AAGAAAAAGAAGAGCAGGAGAGG + Intronic
1144545876 17:16195179-16195201 AAGAAAAAGAAGGCCAGGAGCGG + Intronic
1145722680 17:27088427-27088449 AGGGAAAAGAAGAGCATGAGTGG - Intergenic
1146603231 17:34236210-34236232 AAGCAAATGAAGGCCCAGAGAGG - Intergenic
1146809872 17:35894535-35894557 AGGTGAAAGGAGGGCAGGAGAGG + Intergenic
1147896660 17:43755835-43755857 TGGCAAAAGCAGGGCTGGGGTGG - Intronic
1147978044 17:44259143-44259165 AGGGTAAGGAAGGGCCGGAGAGG - Exonic
1149301120 17:55305344-55305366 AGGTAAAAGAAGGGAGGGAAAGG + Intronic
1150373306 17:64660972-64660994 ATGGAAAAGAATGTCCGGAGGGG - Intronic
1151430749 17:74060809-74060831 AGGCCTAAGCAGGGCAGGAGAGG + Intergenic
1151726288 17:75886683-75886705 AGACAGAACAAGGGCAGGAGAGG - Intronic
1151842271 17:76626989-76627011 GGGCAAGAGAGGGGCTGGAGGGG + Intronic
1152247255 17:79191510-79191532 AGGCACACAAAGGCCCGGAGAGG + Intronic
1152341913 17:79730337-79730359 AGGCACATGAAGGGTGGGAGAGG - Intergenic
1152879416 17:82806804-82806826 GGTCAAGGGAAGGGCCGGAGTGG - Intronic
1152919463 17:83058761-83058783 GGGCATGAGAGGGGCCGGAGAGG + Intergenic
1153185260 18:2478938-2478960 GGGCAGAAGAAGGGCAGTAGGGG + Intergenic
1153284605 18:3446553-3446575 AGGAAAAAGGAGGGCCGGGAAGG + Intronic
1153619083 18:6959479-6959501 ACGGAAAAGAAGGGCTGGGGAGG + Exonic
1153702726 18:7712208-7712230 AGGCAAAACAGGGTCTGGAGCGG + Intronic
1153746085 18:8180956-8180978 AGACACAAGTAGGGCAGGAGAGG - Intronic
1153913229 18:9722069-9722091 AGGAAAGAGAAGGGAGGGAGAGG + Intronic
1154112900 18:11585602-11585624 AGACATAAGCAGGGCAGGAGAGG + Intergenic
1154434780 18:14335183-14335205 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1155797527 18:30059190-30059212 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1156803386 18:41146031-41146053 AGGCACAAGAAGGGCCAGATTGG + Intergenic
1157703574 18:49781378-49781400 ATGAAAAAGAATGGCCTGAGAGG + Intergenic
1157713265 18:49864447-49864469 GGACAAAAGAAGGGGAGGAGGGG - Intronic
1159892812 18:73968537-73968559 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1159906262 18:74095462-74095484 AGGGAATAGAAAGGCCTGAGGGG + Intronic
1160486632 18:79299306-79299328 ACACAAGAGAAGGGCTGGAGAGG - Intronic
1160749882 19:728711-728733 AGGCAGAAGAAGGCCAGGCGCGG + Intronic
1160874613 19:1291244-1291266 AGGAAAAAGATGGGCCGGGCAGG - Intronic
1161041058 19:2110998-2111020 AGGCACAGGAAGGCACGGAGAGG + Intronic
1161280188 19:3441688-3441710 GGGCACAGGAAGGGCCGGAGGGG + Intronic
1161516364 19:4698866-4698888 ATGCAAAAGAAGGCCGGGTGTGG + Intronic
1161960330 19:7519681-7519703 GGGCAGGAGAAGGGCCGGGGCGG - Exonic
1162174921 19:8823513-8823535 AGGCAGAACATGGGCAGGAGAGG - Intronic
1165806369 19:38583545-38583567 AGCCACAAGAAGGGTCTGAGTGG - Intronic
1166932742 19:46311180-46311202 AGGGAAGAGAAGGGGTGGAGAGG - Intronic
1167116402 19:47491540-47491562 TGGCAAAAGAGGGGCCAAAGAGG - Intronic
1202634841 1_KI270706v1_random:36062-36084 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1202636875 1_KI270706v1_random:50831-50853 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
925087893 2:1125415-1125437 AGGCAAAGGAAGGGAGGGAGAGG - Intronic
925445246 2:3921459-3921481 AGGAAAATGGAGGGCTGGAGAGG + Intergenic
927054619 2:19357240-19357262 AGGGAAGAGAAGCGCTGGAGGGG - Intronic
927169535 2:20357343-20357365 AGGCAGAAGAAGGCCGGGCGCGG + Intergenic
927180868 2:20446258-20446280 AGTGAAAAGAGGGGCCGAAGGGG + Intergenic
927468170 2:23352121-23352143 AGGCTGAAGAAGGTCCAGAGGGG - Intergenic
929009274 2:37424931-37424953 AGGCAAGAGTGGGGCAGGAGAGG - Intergenic
929059245 2:37906364-37906386 AGGCAAAAGGACGGCCAGAGAGG + Intergenic
929310514 2:40418991-40419013 AGGCCAAAGAAGGCACAGAGAGG + Intronic
929710713 2:44263692-44263714 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
931884958 2:66607301-66607323 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
934054218 2:88238591-88238613 AGGCAAGGGAAGGCCCAGAGAGG + Intergenic
934165615 2:89291404-89291426 AGGCATGAGATGGGCAGGAGAGG + Intergenic
934201662 2:89891058-89891080 AGGCATGAGATGGGCAGGAGAGG - Intergenic
934587884 2:95520077-95520099 AAGCAAAAGAAAGGCCTCAGAGG - Intergenic
936093565 2:109515773-109515795 AGGCAAAAGTGGAGCAGGAGGGG + Intergenic
936460863 2:112713035-112713057 AGGCAGCAGAAGGGCATGAGGGG - Intergenic
936536016 2:113311846-113311868 AGACAAAACAAGAGCCAGAGTGG + Intergenic
937283499 2:120736114-120736136 AGGCAAGAGAGGGGACCGAGAGG - Intronic
938621010 2:133053121-133053143 AACCAAATGAAGGGCAGGAGGGG - Intronic
939634140 2:144560536-144560558 AGGAAAAGGAAGGGAAGGAGAGG - Intergenic
940378437 2:152985649-152985671 AGGCAGATGAAGGGACTGAGAGG - Intergenic
940768197 2:157812309-157812331 AGGGAAAGAAAGGGCTGGAGGGG + Intronic
941032738 2:160531937-160531959 AGGTCAAAGAAGGGCAGGAAGGG - Intergenic
943189186 2:184654083-184654105 AGGCATAAGCAGGGCAGGATTGG - Intronic
943239118 2:185361779-185361801 AGGCTAAAGAAGTGCAGCAGTGG - Intergenic
943631733 2:190261246-190261268 AGGCAAAAAAAGAGGCGGGGGGG + Intronic
943905086 2:193489503-193489525 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
944091412 2:195916405-195916427 AGACATAAGTAGGGCAGGAGAGG + Intronic
944914436 2:204343820-204343842 AGGCAACAGCAGTGCAGGAGAGG + Intergenic
945280288 2:208029404-208029426 AGACAAAAGAAGGCCGGGTGCGG - Intergenic
946219929 2:218217426-218217448 AGGAGAAACAAGGGCCGGTGAGG - Exonic
946362121 2:219225219-219225241 GGGAAAAAGAAGGGGAGGAGAGG + Intronic
946562788 2:220931559-220931581 AGGCAAAAGTAGGGATGGGGTGG + Intergenic
947156970 2:227172320-227172342 AGGCATGAGCAGGGCAGGAGAGG - Intronic
947441018 2:230121463-230121485 TGGCTAAAGAAGGGCGGCAGTGG + Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948544445 2:238717064-238717086 AGGCAAAAGAGGGGCGGGAGAGG - Intergenic
948691308 2:239706838-239706860 AGGCAAAAGAAAGGCAGGGAAGG - Intergenic
948818062 2:240523611-240523633 AGGCCAAAGCAGGGCTGGCGTGG + Intronic
1168793904 20:598452-598474 AGGAAAAGCAAGGGCCAGAGAGG + Intergenic
1168837173 20:885029-885051 TGGCTAAAGACGGGCAGGAGAGG - Intronic
1169017918 20:2306770-2306792 AGAAAAAAGAAGGGCTGGCGGGG - Intronic
1169519909 20:6359864-6359886 AGGCATAAGCGGGGCAGGAGAGG + Intergenic
1171880996 20:30617247-30617269 CGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1171883002 20:30631761-30631783 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1173780176 20:45749389-45749411 AGGCAAAAGTGGGGCTGGATAGG + Intronic
1173851142 20:46219024-46219046 AGGCAACAGAATGGAAGGAGAGG + Intronic
1174782480 20:53402599-53402621 AGGCAAAAGAAGGCACTGAGGGG + Intronic
1176601433 21:8798522-8798544 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1176626540 21:9096207-9096229 AGGTAAAGGAAGGGCTAGAGTGG + Intergenic
1176647054 21:9361831-9361853 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1177435187 21:21042665-21042687 TGGGAAATGAAGGGCCTGAGGGG - Intronic
1177530721 21:22354926-22354948 AGGCAAGAGTAGGGCAGGAAAGG + Intergenic
1178280496 21:31278428-31278450 AAGCAAAAGAAAGGCCTGAAGGG + Intronic
1178902424 21:36607888-36607910 AGGGAAATGAAGGGCTAGAGGGG + Intergenic
1180343718 22:11690059-11690081 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1180363996 22:11923482-11923504 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1180365868 22:11937166-11937188 AGGTAAAGGAAGAGCCAGAGTGG + Intergenic
1180417052 22:12777072-12777094 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1181588385 22:23867087-23867109 GGGCAAAAGCAGGGTGGGAGGGG + Intronic
1182353684 22:29712661-29712683 AAGCAAAAAAAGGGGCGGAAGGG - Intergenic
949642251 3:6049915-6049937 AGGCAAAAGGAGGGCAGGAGAGG + Intergenic
950869579 3:16217042-16217064 AGACATAAGCAGGGCAGGAGAGG - Intronic
951263484 3:20539897-20539919 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
951933868 3:28000582-28000604 AGACATAAGCAGGGCAGGAGAGG + Intergenic
954457509 3:50607823-50607845 AGGCATAGGCAGGGCCGGGGTGG + Exonic
954522021 3:51237029-51237051 AGGAAGAAGAAGAGCCGGAGGGG - Intronic
956463874 3:69499877-69499899 GGGCAACAGGAAGGCCGGAGAGG - Intronic
956481167 3:69675340-69675362 AGGCAAAAAGTGGGCCGGGGTGG + Intergenic
957822070 3:85389606-85389628 CGGCAAAAGAAGGACATGAGTGG - Intronic
958532380 3:95349983-95350005 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
958603690 3:96331515-96331537 AGGCATAAGTAGGCCAGGAGAGG + Intergenic
958929888 3:100197693-100197715 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
960054069 3:113264282-113264304 ATGCAAAAGAAGGGTGCGAGGGG + Intronic
960533216 3:118788365-118788387 GGGCAAGAGAAGGGAAGGAGGGG - Intergenic
962254304 3:133860009-133860031 AGGCACGTGAAGGGCCGGAGGGG + Intronic
962525780 3:136236381-136236403 AGGGGAAAGAACGGCAGGAGGGG - Intergenic
963458122 3:145573267-145573289 TGGCATAAGCAGGGCAGGAGAGG - Intergenic
964412474 3:156413162-156413184 AGGGACAAGAAGGGTCTGAGTGG + Intronic
964443830 3:156739854-156739876 AGGCAAAAGAAATGGGGGAGGGG - Intergenic
965299069 3:166987730-166987752 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
967357482 3:188588344-188588366 GGGCATAAGAAGGGCAGGGGAGG - Intronic
967870547 3:194225523-194225545 AAGAAAATGAAGGGTCGGAGAGG - Intergenic
967974789 3:195027664-195027686 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
968281605 3:197481340-197481362 TGGCAAAGGAAGGTGCGGAGTGG + Intergenic
1202739828 3_GL000221v1_random:43161-43183 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
969208404 4:5666179-5666201 AGGCAGAAGCAGGGAAGGAGGGG - Intronic
969315923 4:6381270-6381292 AGGGAAGAGGAGGGCAGGAGGGG - Intronic
970069951 4:12146618-12146640 AGACAAAAGAATGGCAGAAGTGG - Intergenic
970168368 4:13263571-13263593 AGGGAAAAGAAGGTAGGGAGAGG + Intergenic
970229106 4:13890841-13890863 AAGCATAAGAAGGGCAGGAGGGG - Intergenic
971934146 4:33125653-33125675 ATGCAAAATAAAGGCCGGGGAGG - Intergenic
972016382 4:34251090-34251112 AGACATAAGCAGGGCAGGAGAGG - Intergenic
972865103 4:43222113-43222135 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
972912146 4:43830781-43830803 AGACATAAGCAGGGCAGGAGAGG + Intergenic
973364756 4:49200314-49200336 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
973393928 4:49578234-49578256 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
973395835 4:49592136-49592158 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
973534690 4:51868713-51868735 ACACAAAAGAAAGGCCTGAGAGG - Intronic
973859021 4:55042156-55042178 AGGCAAAACAGGGTCTGGAGTGG + Intergenic
974627832 4:64446574-64446596 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
975860186 4:78668789-78668811 AGGAAAAAGAAGGGGAAGAGTGG + Intergenic
975908580 4:79244259-79244281 AGGCATGAGCAGGGCAGGAGAGG - Intronic
975973957 4:80073613-80073635 AAGCCAAGGAAAGGCCGGAGTGG + Intronic
976404138 4:84642995-84643017 AGGAGAAAGAAGGGGAGGAGAGG - Intronic
977720808 4:100238369-100238391 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
978000224 4:103548201-103548223 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
979125780 4:116969937-116969959 AGGCATACGCAGGGCAGGAGAGG - Intergenic
979663610 4:123286769-123286791 AGGCTAAAGTAGGGAAGGAGTGG + Intronic
979793458 4:124815127-124815149 AGACAAGAGCAGGGCAGGAGAGG + Intergenic
980271020 4:130583665-130583687 AGACATAAGCAGGGCAGGAGAGG - Intergenic
982638482 4:157926913-157926935 AGGCAAAACAGGGGATGGAGTGG - Intergenic
982996940 4:162360866-162360888 AGTCAAAAGAAGAGGCAGAGAGG - Intergenic
983830560 4:172321760-172321782 AGACAAAAGCAGGGCAGGAGAGG + Intronic
984719681 4:182958050-182958072 AGGAGAAAGAAGGGAAGGAGGGG + Intergenic
1202764191 4_GL000008v2_random:136702-136724 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
985490907 5:178330-178352 AGGCATGAGCAGGGCAGGAGAGG - Intronic
986259888 5:6134860-6134882 TGGCAAGAGAAGGGCTGGGGAGG + Intergenic
986650532 5:9959195-9959217 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
986685699 5:10273739-10273761 AGACATAAGCAGGGCAGGAGAGG - Intergenic
987572026 5:19676396-19676418 AGGCAGGAGCAGGGCAGGAGAGG + Intronic
988228188 5:28442037-28442059 AGGCATAAGCAGGGCAGCAGAGG + Intergenic
990003313 5:50920363-50920385 AGGCAAAACAAGGCCGGGCGCGG - Intergenic
990444601 5:55882191-55882213 AGGCATGAGAAGGACAGGAGAGG - Intronic
990446258 5:55896729-55896751 AGGCAAGGGAAGGGAAGGAGAGG - Intronic
990896163 5:60701874-60701896 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
991657961 5:68921988-68922010 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
992678520 5:79129688-79129710 AGGAAATAGAAGGGCAGAAGTGG + Intronic
993176488 5:84492884-84492906 ACCCAAAAGAAGGGCAGGACTGG + Intergenic
993407027 5:87524648-87524670 AGGCACAAGCAGGGCAGAAGAGG - Intergenic
993791148 5:92212682-92212704 AGGCAGAAGAAGGGCCTCAAAGG - Intergenic
994342525 5:98647865-98647887 AGGAAAATGAAGGGCCTGATTGG - Intergenic
995238323 5:109856601-109856623 AGGCAGAAGAAGGGACAGAATGG + Intronic
995482805 5:112609701-112609723 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
997065704 5:130556250-130556272 AGACATGAGAAGGGCAGGAGAGG + Intergenic
998074738 5:139226360-139226382 AGGCATAAGCAGGGCAGGAGAGG - Intronic
998075280 5:139231471-139231493 AAGCAAAAGAAGGCCGGGCGCGG + Intronic
998384277 5:141747444-141747466 AGAGAAAAGAAGGGAGGGAGGGG + Intergenic
999341983 5:150780213-150780235 AGGGAAGACAAGGGCCAGAGAGG - Intronic
999517360 5:152314579-152314601 AGGAAAAAGAAGGGAAGGGGAGG - Intergenic
1000148075 5:158472696-158472718 AGGGAAAAGAAGGACAGGGGAGG - Intergenic
1000720892 5:164705139-164705161 ATGCAAAAGTTGGGCTGGAGAGG - Intergenic
1001472421 5:172023905-172023927 AAAGAAAAGAAGGGCGGGAGTGG - Intergenic
1001786583 5:174418876-174418898 AGGGAAAGGAAGGGAAGGAGAGG + Intergenic
1001916070 5:175561202-175561224 AGGCATGAGCAGGGCTGGAGAGG + Intergenic
1002320715 5:178373941-178373963 AGGCACGAGTGGGGCCGGAGGGG + Intronic
1002684351 5:180996293-180996315 AGAGAAAAGAAGGGCTGGGGAGG - Intronic
1003143704 6:3492437-3492459 AGCCAAAAGAAGGGCTTTAGGGG + Intergenic
1004271035 6:14195758-14195780 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1005510635 6:26508956-26508978 AGGCAAAAGAAGGGCCGGAGGGG - Exonic
1005886037 6:30098444-30098466 AGGAAAAAGCATGGCAGGAGTGG - Intergenic
1006117011 6:31780864-31780886 AGGCCAAAGAAGGGCAGGTATGG - Exonic
1007904590 6:45446476-45446498 AGACAAAAAAAGGGGGGGAGGGG - Intronic
1008042472 6:46816573-46816595 AGGAAGAAGAAGGGGAGGAGGGG + Intronic
1010478336 6:76317757-76317779 AGGAAAAAGAAGGGAAAGAGGGG - Intergenic
1010653115 6:78478725-78478747 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
1010977224 6:82329484-82329506 AGGCATGAGAAGGGCAGGAAAGG + Intergenic
1013994749 6:116295189-116295211 AGGCAGAAGAAAGGTGGGAGAGG + Intronic
1014049593 6:116936534-116936556 AGGCAAGAGAAGGAGGGGAGGGG + Intergenic
1014738441 6:125121763-125121785 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1014768464 6:125434306-125434328 AGGCATGAGCAGGGCAGGAGGGG - Intergenic
1015001048 6:128216244-128216266 AGGAAAAATAAGGCCGGGAGTGG + Intronic
1017473665 6:154766234-154766256 AGGCAAAAGATGTGGAGGAGAGG + Intronic
1018390216 6:163336106-163336128 TCCCAAAAGAAAGGCCGGAGGGG + Intergenic
1018845916 6:167555368-167555390 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1018876678 6:167827349-167827371 AGGGGAGAGAAGGGGCGGAGGGG - Intronic
1020538473 7:9430424-9430446 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1020787619 7:12590685-12590707 AGGCAACAGAAAGGCCGATGAGG - Intronic
1021968008 7:25941097-25941119 AGGAAGAGGAAGGGCAGGAGTGG + Intergenic
1022066582 7:26864668-26864690 AGGGACACGAAGGGCCTGAGGGG + Exonic
1022607297 7:31828122-31828144 AGGGAAAAGAATGGACAGAGTGG + Intronic
1022736373 7:33079953-33079975 AGACAAGAGCAGGGCAGGAGAGG - Intergenic
1023392112 7:39720638-39720660 AGACATGAGAAGGGCAGGAGAGG - Intergenic
1023998382 7:45175751-45175773 AGGCCAAAGGAAGGCTGGAGGGG - Intronic
1024193953 7:47040605-47040627 AGGCATGAGAAGGGCAGGAGAGG + Intergenic
1025261074 7:57417648-57417670 AGGGAAAAGAAGGGCCACTGGGG - Intergenic
1025277822 7:57599162-57599184 AAGAAAAAGAAGGCCAGGAGCGG - Intergenic
1025689202 7:63745203-63745225 AGGCAAAAGCTGGGCCAGAATGG - Intergenic
1025912434 7:65839451-65839473 AGGCAAAAGCTGGGCCGGAATGG - Intergenic
1026258227 7:68731500-68731522 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1026626796 7:72000865-72000887 AGACATCAGCAGGGCCGGAGAGG + Intronic
1027596861 7:80184759-80184781 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1028342995 7:89746015-89746037 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1028360786 7:89964178-89964200 AGGCATAAGTGGGGCAGGAGAGG + Intergenic
1029413357 7:100429081-100429103 AAGCCAAGGAAGGGCGGGAGTGG - Intronic
1029587191 7:101482299-101482321 AGGAAAAAGAAGGCCAGGCGCGG - Intronic
1030075116 7:105730095-105730117 TGGAAAAAGCAGGGCAGGAGAGG + Intronic
1031141544 7:117948505-117948527 TGGCAAAAGGAGGACAGGAGTGG + Intergenic
1031779860 7:125947479-125947501 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1032361287 7:131257744-131257766 AGGGAAAGGAAGGGGAGGAGAGG + Intronic
1034178833 7:149122220-149122242 GGGCAAAAGATGGCCGGGAGTGG - Intronic
1034267018 7:149785990-149786012 AAGCAAAAGAAGGGCTGGACAGG + Intergenic
1034457001 7:151176033-151176055 AGGCAAGAGAAGGGTTGGGGAGG - Intronic
1034731311 7:153389817-153389839 AGGCATAAGCAGGGCAGAAGAGG + Intergenic
1034852454 7:154507645-154507667 AGGCAAGAGCAGGACTGGAGAGG + Intronic
1035625844 8:1069897-1069919 TGGCAAAAGGAGGACGGGAGGGG - Intergenic
1036482134 8:9149208-9149230 AGGCAAAAAAAGGCCGGGCGTGG + Intronic
1037020235 8:13960723-13960745 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1038404866 8:27314019-27314041 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1038692433 8:29775355-29775377 AGGAAAATGAGGGGCCAGAGGGG + Intergenic
1039055549 8:33533480-33533502 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1039477068 8:37844673-37844695 TGGCAAGAGAAGGGCAGGACTGG + Exonic
1040056065 8:43057665-43057687 AGTGAAAGGAAGGGCCGGCGCGG + Intronic
1040104909 8:43536059-43536081 AAGGTAAAGAAGGGCCAGAGTGG + Intergenic
1041351017 8:56947627-56947649 AGGCATCAGCAGGGCAGGAGAGG + Intergenic
1041777521 8:61539747-61539769 AGGCATAAGCAGCGCAGGAGAGG - Intronic
1043472767 8:80578547-80578569 AGGGAGAAGGAGCGCCGGAGGGG - Intergenic
1044085449 8:87937198-87937220 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1044711994 8:95067443-95067465 AGGAAAATGAAGGCACGGAGAGG - Intronic
1045895213 8:107208269-107208291 AGACACAAGCAGGGCGGGAGAGG + Intergenic
1047252522 8:123191618-123191640 AGGAAAAGGAAGAGCTGGAGTGG - Intronic
1047522092 8:125602825-125602847 AGGCAAAAGAAGGCAAGCAGAGG - Intergenic
1048128343 8:131662935-131662957 AGGCATGAGCAGGGCAGGAGTGG + Intergenic
1049312410 8:141940102-141940124 AGGAGAAAGAAGGGGAGGAGTGG + Intergenic
1049641224 8:143716832-143716854 AGGCCCGAGAAGGGCCTGAGCGG + Intronic
1050636581 9:7619137-7619159 AGGCACCAGCAGGGCAGGAGAGG + Intergenic
1051009006 9:12387175-12387197 AAGAAAAAGAAGAGCCAGAGAGG - Intergenic
1051278829 9:15421793-15421815 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1051944784 9:22554833-22554855 AGGTAAAAGAAGGACAGGAGAGG + Intergenic
1052547664 9:29900897-29900919 AGGCATGAGTAGGGCAGGAGAGG - Intergenic
1052880508 9:33598744-33598766 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1053495465 9:38545467-38545489 AGGGAAAGGAAGGGCCACAGTGG - Intronic
1053666724 9:40322555-40322577 AGGTAAAGGAAGGGCCAGAGTGG + Intronic
1053916323 9:42947664-42947686 AGGTAAAGGACGGGCCAGAGTGG + Intergenic
1054377874 9:64462583-64462605 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1054517886 9:66053728-66053750 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1055077812 9:72235040-72235062 AGGCAAATGAAGGGCCATGGGGG + Intronic
1055985760 9:82055832-82055854 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1056611301 9:88127657-88127679 AGGCAAAGGAAGGGCCAGAGTGG + Intergenic
1057675355 9:97132825-97132847 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1058540948 9:106012040-106012062 AGGTAAAAGAAGGGAAGGAAAGG - Intergenic
1059308615 9:113373638-113373660 AGGCAGGAGATGGGCCAGAGAGG + Exonic
1059901367 9:118930138-118930160 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1061076400 9:128344026-128344048 TTGCAAAAGAAGGCACGGAGTGG + Intronic
1061612806 9:131759548-131759570 AGGAAAAAGAAGGGAGGAAGGGG + Intergenic
1061773427 9:132944884-132944906 GGCAAAAAGAAGGGCCGGCGCGG + Intergenic
1062112885 9:134791722-134791744 AGGCAAAAGAAGGGCGGCCAAGG - Intronic
1062393238 9:136342374-136342396 AAGGAAAAGGGGGGCCGGAGTGG + Intronic
1203749712 Un_GL000218v1:66621-66643 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1203708470 Un_KI270742v1:73118-73140 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1203544939 Un_KI270743v1:121575-121597 AGGTAAAGGAAGGGCCAGAGTGG - Intergenic
1187403972 X:18985319-18985341 AGGAGGAAGAAGGGCCGAAGGGG - Intergenic
1187420755 X:19131580-19131602 AGGGAAGAGAAGGGTGGGAGAGG + Intergenic
1187613527 X:20968811-20968833 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1187775966 X:22757612-22757634 AGGCAAAGGAAGGACAGGAGTGG + Intergenic
1188497774 X:30797222-30797244 AGGCAAAACAAGGCCAGGAAAGG - Intergenic
1188953612 X:36407596-36407618 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1189005223 X:36987118-36987140 TGGGAAAAGAAGGGACGGAAGGG - Intergenic
1189185191 X:39048839-39048861 AGCCAGAGGAAGGCCCGGAGAGG + Intergenic
1190124755 X:47694023-47694045 AGGCAAGAGAAGGCCGGGCGCGG - Intergenic
1191933074 X:66395353-66395375 AGGCTAAAGAAGTGCAGCAGTGG + Intergenic
1192177549 X:68895305-68895327 AGGCCAGAGGAGGGCCGGCGTGG - Intergenic
1192811970 X:74555008-74555030 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1193447327 X:81619970-81619992 TGGCAAAAGAAGTGCAGCAGTGG + Intergenic
1194010262 X:88553420-88553442 AGGAAATAGAGGAGCCGGAGGGG - Intergenic
1194010948 X:88560143-88560165 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194170728 X:90576860-90576882 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194413521 X:93582097-93582119 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194810540 X:98382405-98382427 AGGCATATGCAGGGCAGGAGAGG + Intergenic
1194845956 X:98809408-98809430 AAGGAAAGGAAGGGACGGAGAGG - Intergenic
1194980731 X:100437832-100437854 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1195258397 X:103110388-103110410 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1197492879 X:127140269-127140291 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1197582309 X:128298907-128298929 TGGCATAAGAATGGCTGGAGTGG + Intergenic
1198242053 X:134796669-134796691 AGGGAAAAGAAGCGCAGGGGCGG + Intronic
1198711076 X:139505045-139505067 AGGCACAAGAAGTGATGGAGGGG - Intergenic
1200365884 X:155662933-155662955 TGGCAAAAGAAGTGCAGTAGTGG - Intronic
1200516969 Y:4154607-4154629 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1201163077 Y:11181636-11181658 AGGTAAAGGAAGGGCCAGAGTGG + Intergenic
1201276007 Y:12299524-12299546 AGGCATAAGCAGGGCAGGAAAGG + Intergenic
1201306120 Y:12552037-12552059 AGGCAAGAGGAGAGCCAGAGAGG - Intergenic