ID: 1005512718

View in Genome Browser
Species Human (GRCh38)
Location 6:26525790-26525812
Sequence ATTCACTGCGTGGTGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005512718 Original CRISPR ATTCACTGCGTGGTGGGGTG GGG Intergenic