ID: 1005520438

View in Genome Browser
Species Human (GRCh38)
Location 6:26596623-26596645
Sequence CGGGTTGATGCCGGCTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005520438_1005520449 26 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520449 6:26596672-26596694 TATAGGGTAGGTTATATTTGGGG No data
1005520438_1005520448 25 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520448 6:26596671-26596693 CTATAGGGTAGGTTATATTTGGG No data
1005520438_1005520444 9 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520444 6:26596655-26596677 GTCTCGACAAGGCGTTCTATAGG No data
1005520438_1005520445 10 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520445 6:26596656-26596678 TCTCGACAAGGCGTTCTATAGGG No data
1005520438_1005520446 14 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520446 6:26596660-26596682 GACAAGGCGTTCTATAGGGTAGG No data
1005520438_1005520442 -2 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520442 6:26596644-26596666 CGCCTTTTAGCGTCTCGACAAGG No data
1005520438_1005520447 24 Left 1005520438 6:26596623-26596645 CCTAAAAAGCCGGCATCAACCCG No data
Right 1005520447 6:26596670-26596692 TCTATAGGGTAGGTTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005520438 Original CRISPR CGGGTTGATGCCGGCTTTTT AGG (reversed) Intergenic
No off target data available for this crispr