ID: 1005521439

View in Genome Browser
Species Human (GRCh38)
Location 6:26604259-26604281
Sequence TCCTAATGTAACCTGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005521439_1005521441 9 Left 1005521439 6:26604259-26604281 CCAAGAGTCAGGTTACATTAGGA 0: 1
1: 0
2: 0
3: 1
4: 89
Right 1005521441 6:26604291-26604313 CAACTTGAACTGTTGACTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005521439 Original CRISPR TCCTAATGTAACCTGACTCT TGG (reversed) Intergenic
901209742 1:7518117-7518139 GCTAAATATAACCTGACTCTGGG - Intronic
905922854 1:41730691-41730713 TCCTAATGCCACCTGACGTTGGG - Intronic
908705572 1:66950812-66950834 TCCTAAGGTAACCAATCTCTTGG - Intronic
910997940 1:93129100-93129122 TCCTACTGTAGACTGGCTCTGGG + Intronic
914986062 1:152458091-152458113 ACCTAATGTAAGCTTACTGTGGG + Intergenic
917535957 1:175874815-175874837 CCCTAATGTGACATGATTCTTGG + Intergenic
918241360 1:182623250-182623272 TCAAAATATAACCTGGCTCTGGG + Intergenic
1065815752 10:29481058-29481080 TCCAATTCTAATCTGACTCTGGG - Intronic
1065957173 10:30704144-30704166 TCCAATTCTAATCTGACTCTGGG + Intergenic
1067957588 10:50809463-50809485 TTCTGATGGAACCTAACTCTTGG + Intronic
1069593480 10:69656023-69656045 CCCTCGTGTAACCTGACTATGGG - Intergenic
1073487591 10:103829830-103829852 ACCTAATGCAACCCGACTTTTGG - Intronic
1074714034 10:116201886-116201908 TCCAAATGTTACCTTATTCTTGG - Intronic
1083876471 11:65526634-65526656 GGCTAATGAAACCTGCCTCTTGG + Intronic
1086594129 11:88550992-88551014 TACTAATGTTACCTGTCTCATGG + Intronic
1089430108 11:118416439-118416461 ACCTGATGTCATCTGACTCTGGG + Intronic
1102343441 12:112142048-112142070 TTCTAATGTATCCTGAATGTTGG + Intronic
1111326352 13:86701583-86701605 TCCTAAAGTGACCTGGCCCTAGG + Intergenic
1111413268 13:87905239-87905261 TCCTATTATAACCTGAAACTGGG + Intergenic
1112092521 13:96096460-96096482 TTCTAATGTAAGCTGAGTGTGGG + Intronic
1125385843 15:39135659-39135681 TCCTGATGTAGCCTCACTGTGGG + Intergenic
1129178991 15:73859731-73859753 TCCTCTTCTTACCTGACTCTAGG - Intergenic
1131403896 15:92147735-92147757 TTCTATTGTTACCTGTCTCTGGG + Intronic
1143867286 17:9933294-9933316 ACCTAATGTTCCCTGACACTAGG + Intronic
1144196853 17:12902729-12902751 TCCTAATTTAACCTGAGCTTGGG + Intronic
1145388064 17:22432910-22432932 TATTAATGTATCCTCACTCTCGG + Intergenic
1149253237 17:54794402-54794424 TTCTACTGTAACCTCACCCTTGG - Intergenic
1153375538 18:4373057-4373079 TTTTAGTGTAAGCTGACTCTAGG - Intronic
1154002915 18:10499490-10499512 TCCTAAAGTAAAATGACTCGTGG - Intergenic
1156763226 18:40619447-40619469 TCCTAATGTAACTGATCTCTTGG - Intergenic
1157165586 18:45355683-45355705 GCCTTATGTAGCCTGACTGTGGG - Intronic
1161524919 19:4748287-4748309 TCCTAATGCAGCCTGAATCCTGG + Intergenic
1167947638 19:53001841-53001863 TCCTAAGGTCAGCTTACTCTTGG + Intergenic
929766988 2:44853058-44853080 ACATAATGTACCCTGATTCTAGG + Intergenic
933288591 2:80411356-80411378 TCCTAATGAATCCCTACTCTGGG - Intronic
937485142 2:122307948-122307970 TATTAATTAAACCTGACTCTTGG - Intergenic
939866808 2:147482061-147482083 CCCACATTTAACCTGACTCTGGG - Intergenic
944761445 2:202819101-202819123 TACTGATGGAGCCTGACTCTGGG - Intronic
946135701 2:217645254-217645276 TAATAATGTCACCTGACTCATGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1173274101 20:41564301-41564323 TCCCAATGTAAACTCCCTCTTGG + Intronic
1177760363 21:25396102-25396124 TCCTATTGCAACCTGAGTTTAGG - Intergenic
1181033881 22:20160824-20160846 TCCTAATCTCAGCAGACTCTGGG + Intergenic
1181509473 22:23382579-23382601 TCCTAATCTCAGCAGACTCTGGG - Intergenic
951182132 3:19671382-19671404 TCCTAATGTTACGGGATTCTTGG + Intergenic
956733159 3:72215210-72215232 TCCTAACCTAACCTCACCCTTGG + Intergenic
958052438 3:88365581-88365603 TCCTAAAGTAATCTGGGTCTTGG + Intergenic
958685661 3:97389409-97389431 ACCTAATGTAACTTGAATGTTGG + Intronic
964515783 3:157506171-157506193 TCTTAAAGAAACTTGACTCTTGG - Intronic
965798735 3:172468762-172468784 GCCTAAGGTAACATGATTCTGGG - Intergenic
966614787 3:181901958-181901980 ACCTACTGTCATCTGACTCTTGG + Intergenic
967338665 3:188372464-188372486 TCCTACTGGAATCTGAATCTGGG + Intronic
970187378 4:13472613-13472635 TTCTAATGAAATTTGACTCTTGG - Intronic
970579624 4:17463439-17463461 TCCTAATGAAATCTCCCTCTTGG + Intronic
970991979 4:22223322-22223344 TCCCAGTGTAACCTAACTCCTGG + Intergenic
974198875 4:58612958-58612980 TCCTGATATAACCTGACTACAGG + Intergenic
977294557 4:95196162-95196184 TCCAAATATAACCTTGCTCTTGG + Intronic
978498495 4:109384754-109384776 TCCCAATGTCTCCTGATTCTGGG - Intergenic
979184684 4:117773195-117773217 TTCTTATGTTTCCTGACTCTAGG + Intergenic
981305909 4:143247005-143247027 TCCTAACGTTTCCAGACTCTTGG - Intergenic
982442285 4:155451249-155451271 CCCCAATGTAAACTGACTTTGGG - Intergenic
983542583 4:168928895-168928917 TCTTAAAGTCACCTGACTTTGGG + Intronic
983789371 4:171776481-171776503 TCCTAATATAACTGGTCTCTTGG - Intergenic
984530897 4:180914960-180914982 TCATAATGTCACCTTAATCTTGG - Intergenic
984634179 4:182093037-182093059 TCTTAATGTCACTTGACTATGGG + Intergenic
985118026 4:186611033-186611055 TCCTTATGTAATCAGACTCATGG - Intronic
985622935 5:965032-965054 TCCTCAGGTCACCGGACTCTGGG - Intergenic
991200583 5:63987019-63987041 TCAAAATGTAAGCTGACACTCGG + Intergenic
997654104 5:135542833-135542855 TCCTAATGGAATCTGACTATTGG + Intergenic
1000632716 5:163608904-163608926 TTCTAATGTAGGCTGACCCTAGG - Intergenic
1001498671 5:172210478-172210500 TCCAAATTCAACCTAACTCTTGG + Exonic
1005521439 6:26604259-26604281 TCCTAATGTAACCTGACTCTTGG - Intergenic
1008085665 6:47241763-47241785 TCTTAAAGTTACTTGACTCTTGG - Intronic
1009329152 6:62393982-62394004 TCCTAATGCCATCTCACTCTTGG - Intergenic
1011759747 6:90549465-90549487 GCCTAATGAAAGCTGACACTCGG - Intronic
1012009661 6:93767212-93767234 TCCTAATGCAAATTGACTTTTGG - Intergenic
1013594849 6:111651187-111651209 TCCTAATGAAAAGAGACTCTGGG + Intergenic
1016288217 6:142497868-142497890 TTTTAATGTAAACTGACTCCTGG + Intergenic
1021944518 7:25713521-25713543 ATCTAATGTAACCTTTCTCTGGG - Intergenic
1026283620 7:68944022-68944044 TTCTAATGTCACCTGCCTGTAGG + Intergenic
1040666070 8:49634728-49634750 TTCTAATGTAATGTGACTATGGG + Intergenic
1045395699 8:101758631-101758653 TCCCCATGTGTCCTGACTCTAGG + Intronic
1046759567 8:118007340-118007362 TTCTTATGTAACCTGTCTGTAGG - Intronic
1051192856 9:14533580-14533602 GCTTAAGGTAGCCTGACTCTGGG + Intergenic
1052944686 9:34158736-34158758 TCCTAATGCAATCTGACTGGAGG + Intergenic
1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG + Intergenic
1186442133 X:9595344-9595366 TACTGATGTAACCTGACTGATGG - Intronic
1190843843 X:54172618-54172640 ATTTGATGTAACCTGACTCTTGG - Intronic
1192093317 X:68183954-68183976 AACAAATATAACCTGACTCTAGG + Intronic
1193580938 X:83261721-83261743 TCCTAATTTATTCTGACTGTAGG - Intergenic
1197574495 X:128193772-128193794 TCCTAGTGTAGTCTGCCTCTTGG + Intergenic