ID: 1005522833

View in Genome Browser
Species Human (GRCh38)
Location 6:26614878-26614900
Sequence GATAACTTCCCTCCCATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005522833_1005522838 12 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522838 6:26614913-26614935 GATTATATTTAGAATTCACTGGG No data
1005522833_1005522839 13 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522839 6:26614914-26614936 ATTATATTTAGAATTCACTGGGG No data
1005522833_1005522837 11 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522837 6:26614912-26614934 AGATTATATTTAGAATTCACTGG No data
1005522833_1005522841 19 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522841 6:26614920-26614942 TTTAGAATTCACTGGGGAGGTGG No data
1005522833_1005522840 16 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522840 6:26614917-26614939 ATATTTAGAATTCACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005522833 Original CRISPR GATAACTTCCCTCCCATCCT TGG (reversed) Intergenic
No off target data available for this crispr