ID: 1005522837

View in Genome Browser
Species Human (GRCh38)
Location 6:26614912-26614934
Sequence AGATTATATTTAGAATTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005522833_1005522837 11 Left 1005522833 6:26614878-26614900 CCAAGGATGGGAGGGAAGTTATC No data
Right 1005522837 6:26614912-26614934 AGATTATATTTAGAATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005522837 Original CRISPR AGATTATATTTAGAATTCAC TGG Intergenic
No off target data available for this crispr