ID: 1005525757

View in Genome Browser
Species Human (GRCh38)
Location 6:26646341-26646363
Sequence CAGGCTAAAAATAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005525750_1005525757 26 Left 1005525750 6:26646292-26646314 CCTAACTATATGCTAAATACAAG 0: 1
1: 0
2: 38
3: 274
4: 912
Right 1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG No data
1005525752_1005525757 -2 Left 1005525752 6:26646320-26646342 CCTAAAGCAAAGTGATTCAGGCA 0: 1
1: 0
2: 3
3: 35
4: 277
Right 1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005525757 Original CRISPR CAGGCTAAAAATAAGGAGGT GGG Intronic
No off target data available for this crispr