ID: 1005527498

View in Genome Browser
Species Human (GRCh38)
Location 6:26665321-26665343
Sequence AATTTTCCACAGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005527498_1005527504 13 Left 1005527498 6:26665321-26665343 CCCTCCACCATCTGTGGAAAATT No data
Right 1005527504 6:26665357-26665379 ACTAGTCCCTGGTGCCAAAATGG 0: 43
1: 979
2: 1456
3: 1131
4: 720
1005527498_1005527505 17 Left 1005527498 6:26665321-26665343 CCCTCCACCATCTGTGGAAAATT No data
Right 1005527505 6:26665361-26665383 GTCCCTGGTGCCAAAATGGTTGG 0: 46
1: 1015
2: 1744
3: 1418
4: 1010
1005527498_1005527506 18 Left 1005527498 6:26665321-26665343 CCCTCCACCATCTGTGGAAAATT No data
Right 1005527506 6:26665362-26665384 TCCCTGGTGCCAAAATGGTTGGG 0: 47
1: 1033
2: 1641
3: 1421
4: 945
1005527498_1005527502 2 Left 1005527498 6:26665321-26665343 CCCTCCACCATCTGTGGAAAATT No data
Right 1005527502 6:26665346-26665368 TCTTCCACGAAACTAGTCCCTGG 0: 18
1: 250
2: 1498
3: 1691
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005527498 Original CRISPR AATTTTCCACAGATGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr