ID: 1005527585

View in Genome Browser
Species Human (GRCh38)
Location 6:26666410-26666432
Sequence CTGCTGTTTTAGGGTATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005527585_1005527592 -5 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527592 6:26666428-26666450 AGCAGTCCCCAATCTTGTGGGGG No data
1005527585_1005527598 6 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527598 6:26666439-26666461 ATCTTGTGGGGGCCAGGGACTGG No data
1005527585_1005527593 0 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527593 6:26666433-26666455 TCCCCAATCTTGTGGGGGCCAGG No data
1005527585_1005527589 -8 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527589 6:26666425-26666447 AACAGCAGTCCCCAATCTTGTGG No data
1005527585_1005527590 -7 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527590 6:26666426-26666448 ACAGCAGTCCCCAATCTTGTGGG No data
1005527585_1005527595 1 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527595 6:26666434-26666456 CCCCAATCTTGTGGGGGCCAGGG No data
1005527585_1005527591 -6 Left 1005527585 6:26666410-26666432 CCCTGTATACCCTAAAACAGCAG No data
Right 1005527591 6:26666427-26666449 CAGCAGTCCCCAATCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005527585 Original CRISPR CTGCTGTTTTAGGGTATACA GGG (reversed) Intergenic
No off target data available for this crispr