ID: 1005533491

View in Genome Browser
Species Human (GRCh38)
Location 6:26732094-26732116
Sequence GCTCTTTGTGTTATACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005533491_1005533492 -2 Left 1005533491 6:26732094-26732116 CCAGGATGTATAACACAAAGAGC No data
Right 1005533492 6:26732115-26732137 GCAAACTGTAATGTAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005533491 Original CRISPR GCTCTTTGTGTTATACATCC TGG (reversed) Intergenic
No off target data available for this crispr