ID: 1005537303

View in Genome Browser
Species Human (GRCh38)
Location 6:26769560-26769582
Sequence GCTCTTTGTGTTATACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005537302_1005537303 -2 Left 1005537302 6:26769539-26769561 CCACAGTTTACATTACAGTTTGC No data
Right 1005537303 6:26769560-26769582 GCTCTTTGTGTTATACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005537303 Original CRISPR GCTCTTTGTGTTATACATCC TGG Intergenic
No off target data available for this crispr