ID: 1005549302

View in Genome Browser
Species Human (GRCh38)
Location 6:26897856-26897878
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549302_1005549306 2 Left 1005549302 6:26897856-26897878 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549306 6:26897881-26897903 CAGCTGCAGCAGGTGCCCAGAGG No data
1005549302_1005549303 -8 Left 1005549302 6:26897856-26897878 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549303 6:26897871-26897893 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549302 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr