ID: 1005549479

View in Genome Browser
Species Human (GRCh38)
Location 6:26898673-26898695
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549479_1005549483 2 Left 1005549479 6:26898673-26898695 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549483 6:26898698-26898720 CAGCTGCAGCAGGTGCCCAGAGG No data
1005549479_1005549480 -8 Left 1005549479 6:26898673-26898695 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549480 6:26898688-26898710 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549479 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr