ID: 1005549655

View in Genome Browser
Species Human (GRCh38)
Location 6:26899493-26899515
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549655_1005549659 2 Left 1005549655 6:26899493-26899515 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549659 6:26899518-26899540 CAGCTGCAGTAGGTGCCCAGAGG No data
1005549655_1005549656 -8 Left 1005549655 6:26899493-26899515 CCTTCACATTTCTGGGCCTCAGC No data
Right 1005549656 6:26899508-26899530 GCCTCAGCCACAGCTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549655 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr