ID: 1005549674

View in Genome Browser
Species Human (GRCh38)
Location 6:26899617-26899639
Sequence GAGGCCTTCCGTAGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549674_1005549682 -1 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549682 6:26899639-26899661 CCCGGAACTAAAGCGGAGGAGGG No data
1005549674_1005549680 -2 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549680 6:26899638-26899660 TCCCGGAACTAAAGCGGAGGAGG No data
1005549674_1005549678 -5 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549678 6:26899635-26899657 GCCTCCCGGAACTAAAGCGGAGG No data
1005549674_1005549684 26 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data
1005549674_1005549677 -8 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549677 6:26899632-26899654 AAGGCCTCCCGGAACTAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549674 Original CRISPR GAGGCCTTCCGTAGAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr