ID: 1005549681

View in Genome Browser
Species Human (GRCh38)
Location 6:26899639-26899661
Sequence CCCTCCTCCGCTTTAGTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549681_1005549684 4 Left 1005549681 6:26899639-26899661 CCCGGAACTAAAGCGGAGGAGGG No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549681 Original CRISPR CCCTCCTCCGCTTTAGTTCC GGG (reversed) Intergenic
No off target data available for this crispr