ID: 1005549683

View in Genome Browser
Species Human (GRCh38)
Location 6:26899640-26899662
Sequence ACCCTCCTCCGCTTTAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549683_1005549684 3 Left 1005549683 6:26899640-26899662 CCGGAACTAAAGCGGAGGAGGGT No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549683 Original CRISPR ACCCTCCTCCGCTTTAGTTC CGG (reversed) Intergenic
No off target data available for this crispr