ID: 1005549684

View in Genome Browser
Species Human (GRCh38)
Location 6:26899666-26899688
Sequence AGCCTCATCCCGCTGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005549674_1005549684 26 Left 1005549674 6:26899617-26899639 CCCACAGCTCTACGGAAGGCCTC No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data
1005549681_1005549684 4 Left 1005549681 6:26899639-26899661 CCCGGAACTAAAGCGGAGGAGGG No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data
1005549683_1005549684 3 Left 1005549683 6:26899640-26899662 CCGGAACTAAAGCGGAGGAGGGT No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data
1005549675_1005549684 25 Left 1005549675 6:26899618-26899640 CCACAGCTCTACGGAAGGCCTCC No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data
1005549679_1005549684 7 Left 1005549679 6:26899636-26899658 CCTCCCGGAACTAAAGCGGAGGA No data
Right 1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005549684 Original CRISPR AGCCTCATCCCGCTGCCAGC TGG Intergenic
No off target data available for this crispr