ID: 1005551563

View in Genome Browser
Species Human (GRCh38)
Location 6:26922959-26922981
Sequence AGGAGCAAACACTTTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005551558_1005551563 21 Left 1005551558 6:26922915-26922937 CCATACAGGTATGATATTGGCAG No data
Right 1005551563 6:26922959-26922981 AGGAGCAAACACTTTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005551563 Original CRISPR AGGAGCAAACACTTTGGGGA TGG Intergenic
No off target data available for this crispr