ID: 1005555054

View in Genome Browser
Species Human (GRCh38)
Location 6:26969109-26969131
Sequence CAGTAAAGATGGAGAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005555054_1005555058 16 Left 1005555054 6:26969109-26969131 CCTATTTCTCTCCATCTTTACTG No data
Right 1005555058 6:26969148-26969170 TTGCTGTCACTTCTGGTTGTTGG 0: 1
1: 8
2: 1
3: 12
4: 197
1005555054_1005555057 9 Left 1005555054 6:26969109-26969131 CCTATTTCTCTCCATCTTTACTG No data
Right 1005555057 6:26969141-26969163 TTTGTTGTTGCTGTCACTTCTGG 0: 1
1: 9
2: 1
3: 32
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005555054 Original CRISPR CAGTAAAGATGGAGAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr