ID: 1005565612

View in Genome Browser
Species Human (GRCh38)
Location 6:27090545-27090567
Sequence GTTCATGCATAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005565612_1005565616 18 Left 1005565612 6:27090545-27090567 CCCAGCTCCATCTATGCATGAAC No data
Right 1005565616 6:27090586-27090608 AGGAGAAAAACATATTTTCATGG No data
1005565612_1005565615 -2 Left 1005565612 6:27090545-27090567 CCCAGCTCCATCTATGCATGAAC No data
Right 1005565615 6:27090566-27090588 ACATGAGATGCTATTTCTTGAGG No data
1005565612_1005565617 24 Left 1005565612 6:27090545-27090567 CCCAGCTCCATCTATGCATGAAC No data
Right 1005565617 6:27090592-27090614 AAAACATATTTTCATGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005565612 Original CRISPR GTTCATGCATAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr