ID: 1005567271

View in Genome Browser
Species Human (GRCh38)
Location 6:27108969-27108991
Sequence GCACACTTCCTATACAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005567270_1005567271 9 Left 1005567270 6:27108937-27108959 CCTTTTCAACATTAAATGCATTG No data
Right 1005567271 6:27108969-27108991 GCACACTTCCTATACAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005567271 Original CRISPR GCACACTTCCTATACAAAAT AGG Intergenic
No off target data available for this crispr