ID: 1005567585

View in Genome Browser
Species Human (GRCh38)
Location 6:27112442-27112464
Sequence TAGGCTACCCAAACCCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005567585_1005567588 -4 Left 1005567585 6:27112442-27112464 CCATTATGGGTTTGGGTAGCCTA No data
Right 1005567588 6:27112461-27112483 CCTAGGCTCCCTTTGAAGCTTGG No data
1005567585_1005567591 16 Left 1005567585 6:27112442-27112464 CCATTATGGGTTTGGGTAGCCTA No data
Right 1005567591 6:27112481-27112503 TGGAACAGTCCCTTTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005567585 Original CRISPR TAGGCTACCCAAACCCATAA TGG (reversed) Intergenic
No off target data available for this crispr