ID: 1005569811

View in Genome Browser
Species Human (GRCh38)
Location 6:27133841-27133863
Sequence CAGCTGTTCCACGCGGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005569805_1005569811 13 Left 1005569805 6:27133805-27133827 CCAAAAGAGTTATCGCCCGGGCT 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1005569807_1005569811 -3 Left 1005569807 6:27133821-27133843 CCGGGCTAGAATTTAGCAGACAG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1005569804_1005569811 14 Left 1005569804 6:27133804-27133826 CCCAAAAGAGTTATCGCCCGGGC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1005569806_1005569811 -2 Left 1005569806 6:27133820-27133842 CCCGGGCTAGAATTTAGCAGACA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005569811 Original CRISPR CAGCTGTTCCACGCGGGCCA GGG Exonic
901217013 1:7560611-7560633 TGGCTGTACCACACGGGCCAGGG + Intronic
902609435 1:17588458-17588480 CAGCTGCTCCACCCGGCACAGGG + Exonic
905708689 1:40082187-40082209 CAGCTCTTCCACTCTGGCTACGG - Intronic
906145979 1:43560908-43560930 CACCTATGCCATGCGGGCCAGGG + Intronic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1076991778 11:279479-279501 CAGCTGCTCCGCGAGGTCCACGG - Exonic
1077501694 11:2912357-2912379 CAGCTGGACCAAGAGGGCCAGGG - Intronic
1077711449 11:4541265-4541287 CAGCTGTTCCTGGCATGCCAGGG - Intergenic
1083431246 11:62614562-62614584 CAGCGGTTCCAAGAGGCCCAGGG - Intronic
1083458003 11:62791828-62791850 GGGCTGTTCTGCGCGGGCCAGGG - Exonic
1083690618 11:64406328-64406350 CAGCTGTGACACGCTGGCCCTGG - Intergenic
1084724983 11:70935672-70935694 CAGCTGTCCCACTCGGGGCCCGG - Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1096264156 12:50110530-50110552 CAGCTGCTCCAGACCGGCCAGGG + Exonic
1111085606 13:83372168-83372190 CAGCTGTTCCACTCCAGTCATGG - Intergenic
1118854628 14:69611569-69611591 CAGCTGTACCGCGCGGGCGGGGG - Intergenic
1122905705 14:104800619-104800641 CCGCAGCTCCACGCGCGCCAGGG + Intronic
1124551232 15:30682986-30683008 CAGCAGTTCCTCCCGGGCCCCGG + Intronic
1132462519 16:62476-62498 CAGCTGTTCCTGACGGGCCCCGG + Intronic
1138594599 16:58023109-58023131 CAGATGTTCCCCGCAGGGCAGGG + Intergenic
1141524906 16:84604814-84604836 CTGCTGCTTCAGGCGGGCCAGGG - Intronic
1141953240 16:87352933-87352955 CACCTGTGGCACGTGGGCCAAGG - Intronic
1142191947 16:88722163-88722185 CGGCTGCTCCCCGAGGGCCATGG + Intronic
1142298517 16:89242800-89242822 CAAAAGTTCCAAGCGGGCCAAGG + Intergenic
1143381277 17:6497912-6497934 CAGCAGCTCCACGAGGGGCAGGG - Intronic
1144686335 17:17228564-17228586 CACCTGCTCCATGTGGGCCAAGG + Intronic
1146910903 17:36647836-36647858 CAGCTGAGCCACGTGGGCCTGGG - Intergenic
1147728290 17:42580563-42580585 CAGCTGATCCCCCTGGGCCAAGG + Exonic
1150601265 17:66653019-66653041 CACCTGTTTAACGGGGGCCAGGG - Intronic
1151377379 17:73699192-73699214 CACCTGTTCCACCCATGCCAGGG + Intergenic
1152423843 17:80208413-80208435 CAGCTGTGCCAAGAGGGCCTGGG - Exonic
1155226501 18:23734060-23734082 CACGTGTCCCACGCTGGCCATGG - Intronic
1157283381 18:46360648-46360670 CAGCTCTTCCCTGGGGGCCAGGG + Intronic
1160551254 18:79694968-79694990 CAGCTGTTCCACGGGTGGCACGG + Intronic
1161595748 19:5150290-5150312 CAGGTGCTCCAGGCAGGCCACGG - Intronic
1162386209 19:10361936-10361958 CAGCTGTCCCACTTGGGCCAGGG - Exonic
1162485872 19:10960523-10960545 CAGTGGTTTCCCGCGGGCCAAGG - Intergenic
1163758596 19:19121037-19121059 CAGCTGCTCCACCCGGGCCTTGG + Exonic
1166352876 19:42208628-42208650 CAGCTTGGCCTCGCGGGCCACGG - Intronic
1167121871 19:47522020-47522042 TGGCTGTGCCACGCGGGCCCTGG + Intronic
926181478 2:10648078-10648100 CAGCTGCTCCATGCCGGTCAGGG - Intronic
927640203 2:24841169-24841191 CAGGTCTTCCGCGCTGGCCATGG - Intronic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
927826471 2:26313103-26313125 CAGCTGCTGCAGGCAGGCCAGGG - Exonic
927857843 2:26538296-26538318 CAGCCATTCCCCGTGGGCCAAGG + Intronic
937060043 2:118974373-118974395 CAGGTGGTCCCGGCGGGCCAGGG - Exonic
937284215 2:120739655-120739677 CAGCTGTTCCCGCTGGGCCAGGG + Intronic
943126792 2:183804039-183804061 CAGCTGGTCCCCACGGACCAAGG - Intergenic
1172446765 20:34997297-34997319 CTGCTTCTCCACGCGGGCCCGGG - Exonic
1174369463 20:50076835-50076857 CAGCTGTCACACACGGGCCAAGG - Intergenic
1178830708 21:36054182-36054204 CAGCTGTTCCCTGTGAGCCAAGG + Intronic
1180219988 21:46352419-46352441 CAGCTGCTCCCCGCGGGCTCCGG + Intronic
1183578370 22:38706545-38706567 CTGCTGTCCCGCGCGGTCCAGGG - Intronic
1184580520 22:45413547-45413569 CAGCAGCTCCAGGTGGGCCATGG + Exonic
1184937334 22:47734776-47734798 CAGCTGCTCCCCGCGGGGAATGG + Intergenic
1185258335 22:49848762-49848784 GAGCAGCTCCACGCGGGCCCGGG + Intergenic
950764343 3:15262194-15262216 CAGCTGTCGCATGCGGCCCATGG + Exonic
951232956 3:20200706-20200728 CAGCTGTTCCAGGAGGGATAGGG + Intergenic
954435896 3:50495821-50495843 CAGATTTTCCACGCGGGGAAGGG + Intronic
954902984 3:54035721-54035743 CAGCTGTTCCTCTTGGGCAAGGG - Intergenic
961913489 3:130345796-130345818 CAGCTGTGCGGCGCGGACCAGGG + Exonic
968603749 4:1521924-1521946 GCGCTCTTCCTCGCGGGCCAGGG - Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
985606641 5:861575-861597 CAGCTGTGCATCGCCGGCCAGGG - Intronic
985671428 5:1208899-1208921 GAGCAGTTCCACCCGGGCCCAGG + Intronic
985671441 5:1208938-1208960 AAGCCGTTCCACCCGGGCCCAGG + Intronic
985715927 5:1461512-1461534 CAGCAGGTCCCCGCAGGCCAGGG + Exonic
997663662 5:135609348-135609370 CAGCAGCTCCATGAGGGCCAAGG - Intergenic
997923299 5:138003668-138003690 GACCAGTTCCACGCTGGCCATGG + Intronic
1001891095 5:175339487-175339509 CAGCTCTTCCATGTGGGGCATGG + Intergenic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG + Exonic
1019379620 7:714017-714039 CAGCAGCTCCAGGCAGGCCAGGG - Intronic
1029419889 7:100467025-100467047 CAGCTGCTCCGGGCTGGCCAGGG + Exonic
1037737379 8:21578557-21578579 CAACTGTTCCCCACGGGACAAGG + Intergenic
1039921692 8:41897562-41897584 CAGCTCTTCCCCGCGGGGCACGG - Intergenic
1041045491 8:53882461-53882483 CAGCTGCTGCCCACGGGCCACGG + Intronic
1042397555 8:68309637-68309659 CAGCTGTGCCACACGGGAGATGG - Intronic
1042916197 8:73878420-73878442 CAGCTGTTTCCGTCGGGCCAGGG + Intronic
1046793579 8:118347037-118347059 CAGCTATTCAAGGTGGGCCATGG - Intronic
1050476803 9:6048943-6048965 AAGCTGTTCCAGGCCGGGCACGG - Intergenic
1057037849 9:91824754-91824776 CAGCTCTCCCAGGCGGGACATGG + Intronic
1058006780 9:99924333-99924355 CATGTGTCCCACGTGGGCCATGG + Intronic
1058856729 9:109069607-109069629 CAGCTGTTCCATTCGTGCCATGG + Intronic
1058861168 9:109119247-109119269 CAGCTGTTCCTCCCGGTGCAGGG - Intronic
1059799670 9:117737581-117737603 CTGCTGTTCCAGGCAGCCCAGGG - Intergenic
1061613223 9:131762481-131762503 CATCTGTTCCAGGCGGGGCGGGG + Intergenic
1061848344 9:133400583-133400605 CAGCTGTGCCTCCTGGGCCAAGG + Intronic
1062599539 9:137313660-137313682 CAGGAGTTCCACCCAGGCCAGGG - Intronic
1203773912 EBV:62415-62437 CAGCTCTTCCACGAAGGCAAAGG + Intergenic