ID: 1005570361

View in Genome Browser
Species Human (GRCh38)
Location 6:27139432-27139454
Sequence GGCGGCGTGAAGCGCATTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 3, 2: 3, 3: 7, 4: 15}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005570355_1005570361 4 Left 1005570355 6:27139405-27139427 CCAGCCATTCGGCGCCTTGCTCG 0: 1
1: 4
2: 3
3: 1
4: 39
Right 1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG 0: 1
1: 3
2: 3
3: 7
4: 15
1005570356_1005570361 0 Left 1005570356 6:27139409-27139431 CCATTCGGCGCCTTGCTCGCCGC 0: 1
1: 2
2: 1
3: 2
4: 40
Right 1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG 0: 1
1: 3
2: 3
3: 7
4: 15
1005570359_1005570361 -10 Left 1005570359 6:27139419-27139441 CCTTGCTCGCCGCGGCGGCGTGA 0: 3
1: 0
2: 1
3: 5
4: 50
Right 1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG 0: 1
1: 3
2: 3
3: 7
4: 15
1005570354_1005570361 9 Left 1005570354 6:27139400-27139422 CCAAGCCAGCCATTCGGCGCCTT 0: 1
1: 0
2: 4
3: 7
4: 57
Right 1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG 0: 1
1: 3
2: 3
3: 7
4: 15
1005570352_1005570361 20 Left 1005570352 6:27139389-27139411 CCAGGGTATCACCAAGCCAGCCA 0: 1
1: 0
2: 3
3: 10
4: 216
Right 1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG 0: 1
1: 3
2: 3
3: 7
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005570361 Original CRISPR GGCGGCGTGAAGCGCATTTC TGG Exonic
905491927 1:38351111-38351133 GGCGGGGAGAAGAGCATTTCAGG - Intergenic
906166589 1:43690926-43690948 GTCGAAGTGAAGCACATTTCTGG - Exonic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
1066080918 10:31929261-31929283 GGCGGCGTGCAGCACTTTTTCGG - Intergenic
1083274968 11:61591651-61591673 GGGGGCGTGGGGAGCATTTCAGG + Intergenic
1085022580 11:73218572-73218594 GCCGGCGTGTAGCGCATAACTGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1099738530 12:86601253-86601275 GGCGGCGAGACGGCCATTTCCGG + Intronic
950189581 3:10967236-10967258 GGAGGGGTGAAGGGCATTGCAGG + Intergenic
953679862 3:45030987-45031009 GGAGGCGAGAAGAGCATTGCTGG - Intronic
954432075 3:50476140-50476162 GACGGCGTGATGCGGATTTTTGG - Exonic
971405748 4:26319975-26319997 GGCCGCCTGAAGCGCGATTCGGG + Intronic
986333663 5:6736729-6736751 GGCGGCGTGAGGCGTCTTCCAGG + Intronic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1017940478 6:159048463-159048485 GATGGCGTGAATGGCATTTCAGG - Intergenic
1018182851 6:161239439-161239461 GGCGGAGTTAATCCCATTTCAGG - Intronic