ID: 1005575777

View in Genome Browser
Species Human (GRCh38)
Location 6:27188024-27188046
Sequence CCCTTAGGGTACCTAAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005575777_1005575784 7 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160
1005575777_1005575788 19 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG No data
1005575777_1005575783 -8 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
1005575777_1005575790 21 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575790 6:27188068-27188090 ACATTCTGGTGCCCAACGTGGGG No data
1005575777_1005575789 20 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575789 6:27188067-27188089 AACATTCTGGTGCCCAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005575777 Original CRISPR CCCTTAGGGTACCTAAAGTC CGG (reversed) Intergenic
No off target data available for this crispr