ID: 1005575783

View in Genome Browser
Species Human (GRCh38)
Location 6:27188039-27188061
Sequence CCTAAGGGTGGTATTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005575771_1005575783 20 Left 1005575771 6:27187996-27188018 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
1005575775_1005575783 -5 Left 1005575775 6:27188021-27188043 CCACCGGACTTTAGGTACCCTAA No data
Right 1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
1005575773_1005575783 4 Left 1005575773 6:27188012-27188034 CCTTTGTCGCCACCGGACTTTAG No data
Right 1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
1005575777_1005575783 -8 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005575783 Original CRISPR CCTAAGGGTGGTATTGAGGC TGG Intergenic
No off target data available for this crispr