ID: 1005575784

View in Genome Browser
Species Human (GRCh38)
Location 6:27188054-27188076
Sequence GAGGCTGGTCCCCAACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 3, 1: 3, 2: 3, 3: 16, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005575777_1005575784 7 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160
1005575773_1005575784 19 Left 1005575773 6:27188012-27188034 CCTTTGTCGCCACCGGACTTTAG No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160
1005575775_1005575784 10 Left 1005575775 6:27188021-27188043 CCACCGGACTTTAGGTACCCTAA No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160
1005575781_1005575784 -7 Left 1005575781 6:27188038-27188060 CCCTAAGGGTGGTATTGAGGCTG No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160
1005575782_1005575784 -8 Left 1005575782 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
Right 1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG 0: 3
1: 3
2: 3
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005575784 Original CRISPR GAGGCTGGTCCCCAACATTC TGG Intergenic
900693903 1:3998315-3998337 AAGGCTGATTCTCAACATTCCGG - Intergenic
902956984 1:19932154-19932176 GAGGCTGGTCCTCAACATTCTGG - Intergenic
903557334 1:24203238-24203260 GAGGCTGCTCCCCCACCTGCTGG - Intergenic
903734532 1:25521948-25521970 GAGCCTGGTCCCCAACACCCTGG + Intergenic
904225909 1:29019203-29019225 CAGGCTGGTCCCAAACACTCGGG - Intronic
904461038 1:30679916-30679938 CAGCCTGGCCCCCAGCATTCAGG - Intergenic
904915921 1:33970642-33970664 GAGGCTCATCCCCAGCCTTCAGG + Intronic
905367570 1:37462233-37462255 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
905659184 1:39708129-39708151 CAGGCTGGTCTTGAACATTCTGG - Intronic
908381834 1:63604331-63604353 GAGGCTGGGTCCCAACATCATGG - Intronic
912062177 1:105687014-105687036 CAGCCTGGTCCCCAGGATTCAGG + Intergenic
913327062 1:117636486-117636508 TAGGCTGGTCACCCTCATTCCGG - Intergenic
914003951 1:143716763-143716785 CAGGCTGGTCCCCAAACTCCTGG - Intergenic
914981436 1:152418085-152418107 GAGGCTTTTGCCAAACATTCTGG - Intergenic
915410620 1:155698972-155698994 GAGGCTGGTCCCCTACATTCTGG - Intronic
920451906 1:206065733-206065755 GAGGCAGCTTCCCAACATGCTGG - Intronic
921228510 1:213045109-213045131 GAGGCTGGTCCCCAACATAGTGG - Intergenic
922190271 1:223312728-223312750 GAGGCTGGGCTCCCTCATTCAGG + Intronic
1065732154 10:28719147-28719169 CAGGCTGGTCCCAAACTTTTAGG - Intergenic
1066641350 10:37557393-37557415 CAGGCTGGTCTCCAACTCTCAGG + Intergenic
1066662452 10:37749687-37749709 CTGGCTGGTCCCCAAGTTTCTGG - Intergenic
1068081438 10:52322691-52322713 GAGGTTGGTTCCTGACATTCAGG + Intergenic
1068938431 10:62657925-62657947 CAGCCTGGTCCCCAGGATTCAGG - Intronic
1069518457 10:69098747-69098769 CAGGCTGGTCCCAAACCTCCTGG - Intronic
1071438496 10:85668794-85668816 AAGGCAGGTCACCAATATTCAGG + Intronic
1073568767 10:104558185-104558207 GAGGCTGGGCCCCAGCTTTTGGG - Intergenic
1075200516 10:120399562-120399584 GAGCCTGGTTCCCAGCATTCTGG - Intergenic
1076629272 10:131842628-131842650 GAGCCTGGTCCCCACCTTTCTGG - Intergenic
1077445925 11:2590808-2590830 GAGGCTGGACCCCACTGTTCCGG + Intronic
1081334630 11:41849277-41849299 GAGGCTGTTCCCCAGCCTGCAGG + Intergenic
1083066798 11:59932128-59932150 CAGCCTGGTCCCCAAACTTCAGG + Intergenic
1083593375 11:63907899-63907921 GAGGCTGCTCCCCCACAGCCAGG - Intronic
1083649588 11:64193870-64193892 CAGGCTGGTCCCAAACCTTTGGG - Intronic
1091828523 12:3533167-3533189 GTGGCTTGCCCCCAACATCCAGG + Intronic
1094715561 12:33011626-33011648 AAGGATGGCCCCCAACCTTCTGG + Intergenic
1095786205 12:46110913-46110935 GTGGCTCTTCCCCAACAGTCAGG + Intergenic
1096160290 12:49370922-49370944 CAGGCTGGTCCCCAACTCTTGGG + Intronic
1097657685 12:62388341-62388363 CAGGCTGGTCTCGAACTTTCGGG + Intronic
1101843907 12:108346466-108346488 GTGGCTGTTCCCCAGCACTCAGG + Intergenic
1101919018 12:108917854-108917876 CAGGCTGGTCTCAAACATCCGGG + Intronic
1105467934 13:20664508-20664530 GGGGCTGGTCCACACCATTATGG - Intronic
1109426229 13:62168433-62168455 CAGCCTGGCCCCCAGCATTCAGG - Intergenic
1112006943 13:95261885-95261907 CAGGCTGGTCTCGAACATTTGGG - Intronic
1112068883 13:95825725-95825747 GGAGCTGTACCCCAACATTCAGG - Intronic
1112575067 13:100628037-100628059 GTGGTAGGTTCCCAACATTCAGG + Intronic
1113117880 13:106892858-106892880 GAGGATGGTCCCCAGACTTCTGG + Intergenic
1113379958 13:109795202-109795224 GAACCTGTTTCCCAACATTCTGG - Intergenic
1113986873 13:114324602-114324624 GGGGATGGTCCCCAAGGTTCTGG - Exonic
1115072616 14:29343137-29343159 GAGGCTGGTCTCGAACTTTTGGG + Intergenic
1115221052 14:31058784-31058806 CAGGCTGGTCCCCAACTTCTGGG + Intronic
1116446207 14:45015091-45015113 CAGGCTGGTCCCAAACTCTCGGG - Intronic
1118410098 14:65469931-65469953 CAGCCCGGTCCCCAACGTTCAGG + Intronic
1123102535 14:105815028-105815050 CAGGCTGGTCCCAAACCTCCTGG + Intergenic
1123430881 15:20215300-20215322 CAGGCTGGTCTCCAACTTTTGGG + Intergenic
1126615941 15:50579982-50580004 CAGGCTGGTCCCCAACACCTGGG + Intronic
1127272508 15:57414103-57414125 GAGGCTGATCACCAAGAGTCTGG - Intronic
1128785573 15:70394467-70394489 CAGGCTGGTCTCAAACTTTCTGG - Intergenic
1128807482 15:70541840-70541862 GAGGCTGGTCTCAGACAATCAGG - Intergenic
1129369047 15:75076591-75076613 CAGCCTGGTCCCCAGCCTTCAGG + Intronic
1130283325 15:82535977-82535999 CAGGCTGGTCTCCAACCCTCAGG + Intergenic
1131292688 15:91120601-91120623 CAGGCTGGTTTCCAACTTTCGGG - Intronic
1133201105 16:4205110-4205132 TAGGCTGGTCTCCAACTTTTGGG - Intronic
1133418522 16:5625310-5625332 GAGGGTGGTCCCCAGCTGTCAGG + Intergenic
1134652958 16:15925346-15925368 CAGGCTGGTCTCCAACTCTCTGG - Intergenic
1136853768 16:33635930-33635952 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
1139335012 16:66225653-66225675 CAGGGTGGACACCAACATTCTGG - Intergenic
1141835061 16:86532900-86532922 GAGGCAGCTCCCCATTATTCTGG - Intronic
1144044419 17:11442126-11442148 GAGGTTGCTCACCAACATTTTGG + Intronic
1144246454 17:13370800-13370822 CAGGCTGGTGACCAACATCCTGG + Intergenic
1145287879 17:21520078-21520100 CAGGCTGGTCTCCAACACTAGGG + Intergenic
1147039768 17:37709463-37709485 CAGGCTGGTCTCAAACTTTCTGG + Intronic
1147042387 17:37728731-37728753 CAGGCTGGAGCCCAGCATTCAGG - Intronic
1147061181 17:37879788-37879810 GAGGCTGGTCTCGAACATCTGGG - Intergenic
1148982680 17:51592249-51592271 GAGGTGGGTTCCCCACATTCCGG - Intergenic
1150803855 17:68303334-68303356 CAGGCTGGTCTCCAACTCTCAGG + Intronic
1151143389 17:72016676-72016698 GAGGCTGTTCCTCAATATGCTGG + Intergenic
1152760512 17:82104957-82104979 GGAGCTGGTCCCCAGCTTTCTGG + Intronic
1153535440 18:6097460-6097482 GAGGCTGGACCCCTGCATTTTGG + Intronic
1154311200 18:13267703-13267725 GAGGCTGGGGCCCCGCATTCTGG + Intronic
1158397463 18:57090360-57090382 AAGGCTGCTCCCAAATATTCTGG + Intergenic
1163767535 19:19171834-19171856 GGGGCTGGTCCCCCAAACTCAGG + Intronic
1164253073 19:23501260-23501282 GAGGCTGGTCTCAAACTTTTGGG + Intergenic
1165258603 19:34595160-34595182 GAGGCTGGTCCCCAACATGTAGG - Exonic
1166076203 19:40415027-40415049 GAGGGAGGCCCCCAGCATTCCGG - Intergenic
1166619464 19:44283211-44283233 AAGGCTGATCCCCAACAGTAAGG - Intronic
1167156272 19:47741221-47741243 GAGCTTGGTCCCCACCATCCAGG - Exonic
1167269053 19:48497947-48497969 GGGGCTGGACCCCAACTCTCGGG + Exonic
1167845638 19:52162085-52162107 GAGGTTGGGTCCCAACATCCTGG + Intronic
1167881882 19:52465919-52465941 GAGGCTGGTCCCCAACAGCTTGG - Intronic
925743893 2:7028958-7028980 GAGGCTTGACCCCAAAAATCAGG + Intronic
927072902 2:19548469-19548491 TAGTCTGGTCCCCAGCCTTCAGG - Intergenic
927455119 2:23242379-23242401 GATGCTGGCCCACAGCATTCAGG - Intergenic
929701697 2:44168517-44168539 GGGGCTGGTCCCTGACGTTCGGG + Intronic
937493554 2:122394802-122394824 GAGGCTGGTGTCCAAGATTAAGG + Intergenic
939823769 2:146988914-146988936 CAGGCTGGTCTCCAACTTTTGGG - Intergenic
940834064 2:158500897-158500919 GAGGCTGGGCATCAAGATTCTGG - Intronic
944666831 2:201965803-201965825 CAGGCTGGTCTCAAACATCCTGG - Intergenic
944668968 2:201979672-201979694 CAGGCTGGTCCCGAACAGGCTGG + Intergenic
948075830 2:235164462-235164484 GTGTCAGGTCCCCAACATTGGGG - Intergenic
948416677 2:237811477-237811499 CAGGCTGGTCCCAAACTTCCTGG + Intronic
948476107 2:238221069-238221091 CAGCCTGGCCCCCAACCTTCAGG + Intergenic
1171131894 20:22661583-22661605 GAGGCTGGGCCGCAGCATTCAGG + Intergenic
1172073088 20:32272972-32272994 GAGTCTCCTCCCCAAGATTCTGG + Intergenic
1173495477 20:43514755-43514777 GAGGCGGGCCCCCAACAGGCGGG + Exonic
1173990048 20:47295180-47295202 CAGGCTGGTCTCCAACACTGGGG - Intronic
1182012594 22:27012767-27012789 CAGGCTGGTCCCCACCACTGAGG - Intergenic
1182051463 22:27315822-27315844 GAGGCTGGTCACAGACATTGGGG - Intergenic
1182319551 22:29469884-29469906 GTGGCCGGTCCCCAACCTCCAGG + Intergenic
1183305775 22:37082307-37082329 GAGGCGGGGCCCCAGCATTCAGG - Intronic
953711214 3:45272848-45272870 GAGCCTGGTGACCATCATTCAGG - Intergenic
955315031 3:57931316-57931338 CAGGCTGGTCTCGAACCTTCTGG + Intergenic
956744484 3:72300627-72300649 GAGGCTGTTGCCAAACATCCAGG - Intergenic
957726177 3:84070639-84070661 GAGACAGATCCCCAAAATTCAGG + Intergenic
961228249 3:125274450-125274472 GAGGCTGGTCCCTGAAATTCTGG - Intronic
962424808 3:135260498-135260520 GAGGGTTGTCCCCAAATTTCAGG + Intergenic
962712916 3:138102662-138102684 GGAGGTGGACCCCAACATTCAGG - Intronic
962989097 3:140562480-140562502 GGGACTGGTCCCCAAGATGCTGG - Intronic
963742137 3:149091029-149091051 GATGCTGGTCCCCAACGGTGAGG + Intergenic
963993220 3:151677552-151677574 GAGGCTGGTCCCAAACCTCTGGG + Intergenic
965924304 3:173958663-173958685 CAGCCTGGCCCCCAAGATTCAGG + Intronic
968129986 3:196187417-196187439 GTGGCAGGTCCCCTGCATTCTGG - Intergenic
968441078 4:624904-624926 CAGGCAGCCCCCCAACATTCAGG + Intergenic
968640094 4:1710049-1710071 GAGGCTGGTCCCCAACAATGGGG + Intronic
968977118 4:3827809-3827831 GAGGCTGGTCCTCCACCATCGGG - Intergenic
972655437 4:41059384-41059406 GGGGCTTGCCCCCAACATCCTGG - Intronic
976090780 4:81455224-81455246 CAGGCTGGTCTCCAACTTTTGGG - Intronic
976601679 4:86943612-86943634 CAGGCTGGTCCCGAAAATGCTGG - Intronic
976675491 4:87697870-87697892 CAGGCTGGCCCCCAGCCTTCAGG + Intergenic
979267250 4:118717911-118717933 CAGGCTGGTCTCCAGCTTTCAGG - Intergenic
980146814 4:128996012-128996034 GAGGGTGGTCCCCAGAATACTGG - Intronic
981641706 4:146951414-146951436 CAGGTTGGTCCTGAACATTCAGG + Intergenic
986780856 5:11064427-11064449 GAGGCTGATTCCCACCATCCGGG + Intronic
987366732 5:17155309-17155331 GAGGCTGGCCCCCTACATTTAGG - Intronic
991048114 5:62244254-62244276 CAGGCTGGTCTCCAACTTTTGGG + Intergenic
992300921 5:75379446-75379468 GAGGCTGGTGCCCATCCTCCAGG + Exonic
992667554 5:79026004-79026026 AAGGCTGGACCACCACATTCTGG + Intronic
997629581 5:135356664-135356686 GAGGCTGGCCCCCACCATTTAGG + Intronic
1003591872 6:7443569-7443591 GAGGCTGGTCTCCAACACCTGGG + Intergenic
1005396761 6:25390530-25390552 CAGGCTGGTCTCCAACTTTTGGG + Intronic
1005575784 6:27188054-27188076 GAGGCTGGTCCCCAACATTCTGG + Intergenic
1006151108 6:31990499-31990521 GAGGCTGGTCCCCAACATTCTGG - Intronic
1006157409 6:32023237-32023259 GAGGCTGGTCCCCAACATTCTGG - Intronic
1007260699 6:40561210-40561232 GGGACTGGTCCCCTACCTTCAGG + Intronic
1008573310 6:52835717-52835739 GAGGCTGGTGCCCAGGATGCTGG - Intronic
1010979841 6:82359422-82359444 AAGGCTGGACCACCACATTCTGG + Intergenic
1011622427 6:89255594-89255616 AAGGCAGGTCCCCACCATGCCGG - Intergenic
1021298066 7:18934253-18934275 GAGATTTGTCCCCAACATTCTGG + Intronic
1026429077 7:70326032-70326054 GAGGCTGGTCCCCATCAGCAGGG - Intronic
1028951819 7:96644745-96644767 TGGGCTGGTGCCCAACTTTCAGG - Intronic
1034043007 7:147899127-147899149 TAGGCTGGTCTCCAACTTTTGGG - Intronic
1034367162 7:150561067-150561089 GAGGCTGGACCCCAACAAAAGGG - Intergenic
1036635691 8:10548402-10548424 GAGGCTTGTCCCCACCCTCCCGG + Intronic
1038326283 8:26575198-26575220 GAGGCTGGTCTCCAACTCTTGGG + Intronic
1038452819 8:27650819-27650841 GGGACTGGTAACCAACATTCTGG + Intronic
1039849111 8:41346951-41346973 CAGGCTGGTCCCCAAGTCTCTGG - Intergenic
1040453722 8:47575214-47575236 GAAGGTGGTCCCCACCATTCAGG + Intronic
1040757581 8:50797983-50798005 GAGGCTGGTCTCGAACTTTTGGG + Intergenic
1041622429 8:59988748-59988770 CAGGCTGGTCTCCAACTTCCAGG + Intergenic
1043607814 8:82024039-82024061 CAGGCTGGTCTCGAACATTCTGG + Intergenic
1043969117 8:86510911-86510933 CAGGCTGGTCTCAAACATCCTGG - Intronic
1050162892 9:2736313-2736335 CAGGCTGGTCTCCAACTTCCGGG + Intronic
1055392910 9:75842599-75842621 GAGGCTGGTGGCCAACATATTGG + Intergenic
1055522452 9:77095219-77095241 CAGGCTGATCTCCAACATTTAGG + Intergenic
1056192051 9:84194476-84194498 CAGCCTGGTCCCCAGCCTTCGGG + Intergenic
1057137649 9:92704956-92704978 GAGGCTGGGCCTCAGTATTCTGG - Intergenic
1057468538 9:95337664-95337686 CAGCCCGGTCCCCAACCTTCAGG - Intergenic
1057616613 9:96596648-96596670 CAGGCTGGTCTCCAACTTCCGGG - Intronic
1058402789 9:104636896-104636918 GAGCCTGGTCCCCAAGAGGCAGG - Intergenic
1058500829 9:105614079-105614101 GAGGCTGGACCCCAGTAGTCAGG + Intronic
1060189070 9:121580954-121580976 GAGGCTGTACCCCAAAATCCAGG + Intronic
1061388929 9:130306535-130306557 GAGTCCCGTCCCCACCATTCAGG + Intronic
1061938670 9:133872480-133872502 GAGGCTGTGCCCCCACATGCTGG - Intronic
1185750326 X:2605826-2605848 GAGGCTGGTCCCTGACTCTCTGG + Intergenic
1186330657 X:8528742-8528764 CAGGCTGGTCTCAAACATTCAGG + Intergenic
1188586560 X:31783276-31783298 GAGTCTTGTCTCTAACATTCAGG - Intronic
1190302329 X:49064162-49064184 GATGCTGGTCCCTAACTGTCAGG + Intronic
1192196453 X:69031936-69031958 GAGGCTGGTCCCCAGAATATGGG + Intergenic
1194777603 X:97984125-97984147 TAAGCTGCACCCCAACATTCTGG + Intergenic
1195589870 X:106612105-106612127 GAGGCTGGTCCCTCACATGCAGG + Exonic
1195606508 X:106811312-106811334 GAGGCTGGTCTCCAACTCCCGGG - Intronic
1196822859 X:119716541-119716563 CAGGCTGGTCACGAACTTTCAGG - Intergenic
1197196194 X:123703675-123703697 CAGGCTGGTCCCAAACTTTTGGG - Intronic
1201347474 Y:13000530-13000552 GAAGCTGGTCCCCAACATTCTGG - Intergenic
1201432573 Y:13920133-13920155 CAGGCTGGTCTCAAACATTCAGG - Intergenic
1201666739 Y:16466086-16466108 GAGGCTGGAGACCATCATTCTGG + Intergenic