ID: 1005575788

View in Genome Browser
Species Human (GRCh38)
Location 6:27188066-27188088
Sequence CAACATTCTGGTGCCCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005575782_1005575788 4 Left 1005575782 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG No data
Right 1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG No data
1005575777_1005575788 19 Left 1005575777 6:27188024-27188046 CCGGACTTTAGGTACCCTAAGGG No data
Right 1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG No data
1005575781_1005575788 5 Left 1005575781 6:27188038-27188060 CCCTAAGGGTGGTATTGAGGCTG No data
Right 1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG No data
1005575775_1005575788 22 Left 1005575775 6:27188021-27188043 CCACCGGACTTTAGGTACCCTAA No data
Right 1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005575788 Original CRISPR CAACATTCTGGTGCCCAACG TGG Intergenic
No off target data available for this crispr